Incidental Mutation 'R3109:Drd4'
ID263701
Institutional Source Beutler Lab
Gene Symbol Drd4
Ensembl Gene ENSMUSG00000025496
Gene Namedopamine receptor D4
SynonymsD4R, Drd-4
MMRRC Submission 040583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3109 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141292006-141296464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141292282 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 82 (V82E)
Ref Sequence ENSEMBL: ENSMUSP00000026569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026569] [ENSMUST00000080553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026569
AA Change: V82E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026569
Gene: ENSMUSG00000025496
AA Change: V82E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 182 9.6e-9 PFAM
Pfam:7tm_1 48 368 1.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080553
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209649
Predicted Effect probably benign
Transcript: ENSMUST00000210062
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are less active in open field tests and have reduced responses to novelty. However, mice exhibit locomotor supersensitivity to ethanol, cocaine, and methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,442,456 E323G probably damaging Het
Adamts20 T C 15: 94,345,904 probably benign Het
Alkbh3 T C 2: 94,004,763 E80G probably damaging Het
Amfr T C 8: 94,000,306 Y93C probably damaging Het
Arid2 T C 15: 96,356,746 Y158H probably damaging Het
Camk1g T C 1: 193,354,993 Y133C probably damaging Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd1b G A 1: 139,041,916 probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Fat1 G A 8: 45,045,173 probably null Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Igfn1 T C 1: 135,997,848 D56G probably benign Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Klhdc4 A C 8: 121,821,334 H72Q probably damaging Het
Kmt2c A G 5: 25,275,735 Y1459H probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Per2 A T 1: 91,445,575 C164S probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbl2 T A 8: 91,102,235 I588N probably benign Het
Rslcan18 C T 13: 67,098,607 E314K possibly damaging Het
Ubr3 A T 2: 69,988,840 T1325S probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Other mutations in Drd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Drd4 APN 7 141292183 missense probably damaging 1.00
IGL01542:Drd4 APN 7 141293831 unclassified probably benign
R2314:Drd4 UTSW 7 141293941 missense probably damaging 1.00
R2484:Drd4 UTSW 7 141294736 missense probably benign
R3054:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3055:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3108:Drd4 UTSW 7 141292282 missense possibly damaging 0.95
R4597:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R4964:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R4966:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R5474:Drd4 UTSW 7 141293728 missense probably damaging 1.00
R6010:Drd4 UTSW 7 141294796 missense probably damaging 1.00
R6480:Drd4 UTSW 7 141294793 missense possibly damaging 0.71
R7206:Drd4 UTSW 7 141292119 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTCAGCAGTGGCACCATGG -3'
(R):5'- TGGGTAGGTAGCTCTCAGAC -3'

Sequencing Primer
(F):5'- CAGTGGCACCATGGGGAAC -3'
(R):5'- CTCTCAGACAGAGTAGGAAGGAATCC -3'
Posted On2015-02-05