Incidental Mutation 'R3109:Fyn'
ID263709
Institutional Source Beutler Lab
Gene Symbol Fyn
Ensembl Gene ENSMUSG00000019843
Gene NameFyn proto-oncogene
SynonymsSrc Kinase p59
MMRRC Submission 040583-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3109 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39368855-39565381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 39551455 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 445 (D445H)
Ref Sequence ENSEMBL: ENSMUSP00000114188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063091] [ENSMUST00000099967] [ENSMUST00000126486] [ENSMUST00000135242] [ENSMUST00000136659] [ENSMUST00000146287]
Predicted Effect probably damaging
Transcript: ENSMUST00000063091
AA Change: D445H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057707
Gene: ENSMUSG00000019843
AA Change: D445H

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099967
AA Change: D448H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097547
Gene: ENSMUSG00000019843
AA Change: D448H

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 1.65e-33 SMART
TyrKc 271 520 1.08e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123205
Predicted Effect probably damaging
Transcript: ENSMUST00000126486
AA Change: D445H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115233
Gene: ENSMUSG00000019843
AA Change: D445H

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135242
AA Change: D445H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117111
Gene: ENSMUSG00000019843
AA Change: D445H

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136659
AA Change: D393H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118131
Gene: ENSMUSG00000019843
AA Change: D393H

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 4.37e-33 SMART
TyrKc 222 465 7.5e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146287
AA Change: D445H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114188
Gene: ENSMUSG00000019843
AA Change: D445H

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153722
Meta Mutation Damage Score 0.9743 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Different targeted allele homozygotes show different defects, including seizure susceptibility, anxiety, impaired suckling, myelination, LTP and spatial learning, and defects in immune system, circadian rhythm, testes weight and olfactory bulb formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,442,456 E323G probably damaging Het
Adamts20 T C 15: 94,345,904 probably benign Het
Alkbh3 T C 2: 94,004,763 E80G probably damaging Het
Amfr T C 8: 94,000,306 Y93C probably damaging Het
Arid2 T C 15: 96,356,746 Y158H probably damaging Het
Camk1g T C 1: 193,354,993 Y133C probably damaging Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd1b G A 1: 139,041,916 probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igfn1 T C 1: 135,997,848 D56G probably benign Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Klhdc4 A C 8: 121,821,334 H72Q probably damaging Het
Kmt2c A G 5: 25,275,735 Y1459H probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Per2 A T 1: 91,445,575 C164S probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbl2 T A 8: 91,102,235 I588N probably benign Het
Rslcan18 C T 13: 67,098,607 E314K possibly damaging Het
Ubr3 A T 2: 69,988,840 T1325S probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Other mutations in Fyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Fyn APN 10 39533921 nonsense probably null
IGL02626:Fyn APN 10 39526802 missense probably damaging 1.00
H8562:Fyn UTSW 10 39511954 missense probably benign 0.00
R0128:Fyn UTSW 10 39511982 missense probably benign 0.00
R0130:Fyn UTSW 10 39511982 missense probably benign 0.00
R0336:Fyn UTSW 10 39526901 missense possibly damaging 0.52
R1446:Fyn UTSW 10 39522779 missense probably benign 0.43
R1498:Fyn UTSW 10 39532124 missense possibly damaging 0.90
R1539:Fyn UTSW 10 39532070 missense possibly damaging 0.94
R1912:Fyn UTSW 10 39526832 missense possibly damaging 0.94
R2198:Fyn UTSW 10 39529545 missense probably benign 0.13
R2339:Fyn UTSW 10 39522785 missense probably benign 0.00
R3107:Fyn UTSW 10 39551455 missense probably damaging 1.00
R5068:Fyn UTSW 10 39526843 missense probably damaging 1.00
R5233:Fyn UTSW 10 39529940 missense probably benign
R5929:Fyn UTSW 10 39551461 missense probably damaging 1.00
R6360:Fyn UTSW 10 39526883 missense possibly damaging 0.83
R6379:Fyn UTSW 10 39455074 start gained probably benign
R6490:Fyn UTSW 10 39551402 missense probably damaging 1.00
R7179:Fyn UTSW 10 39532124 missense possibly damaging 0.90
R8087:Fyn UTSW 10 39529557 nonsense probably null
R8246:Fyn UTSW 10 39529529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCATAATTCATCGCCAC -3'
(R):5'- CCCTGGCTAAATACCTTGGC -3'

Sequencing Primer
(F):5'- GCATAATTCATCGCCACACCCG -3'
(R):5'- CCTGGCTAAATACCTTGGCAGAAG -3'
Posted On2015-02-05