Mutagenetix > Incidental Mutation

Incidental Mutation 'R3109:Ptprn2'

263711

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

040583-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R3109 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116876180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 441 (D441G)

Ref Sequence

ENSEMBL: ENSMUSP00000139978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably benign
Transcript: ENSMUST00000070733
AA Change: D441G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: D441G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189009

Predicted Effect

probably benign
Transcript: ENSMUST00000190247
AA Change: D441G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: D441G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Meta Mutation Damage Score

0.0796

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	G	2: 152,442,456 (GRCm38)	E323G	probably damaging	Het
Adamts20	T	C	15: 94,345,904 (GRCm38)		probably benign	Het
Alkbh3	T	C	2: 94,004,763 (GRCm38)	E80G	probably damaging	Het
Amfr	T	C	8: 94,000,306 (GRCm38)	Y93C	probably damaging	Het
Arid2	T	C	15: 96,356,746 (GRCm38)	Y158H	probably damaging	Het
Camk1g	T	C	1: 193,354,993 (GRCm38)	Y133C	probably damaging	Het
Cnnm1	T	C	19: 43,441,561 (GRCm38)	C373R	probably damaging	Het
Cnot1	A	G	8: 95,735,749 (GRCm38)	V1691A	probably damaging	Het
Cubn	T	C	2: 13,362,347 (GRCm38)	S1571G	possibly damaging	Het
Dclk2	G	A	3: 86,920,035 (GRCm38)	P46S	probably damaging	Het
Dennd1b	G	A	1: 139,041,916 (GRCm38)		probably benign	Het
Dmrt2	C	A	19: 25,677,691 (GRCm38)	T218N	probably benign	Het
Drd4	T	A	7: 141,292,282 (GRCm38)	V82E	possibly damaging	Het
Fat1	G	A	8: 45,045,173 (GRCm38)		probably null	Het
Fyn	G	C	10: 39,551,455 (GRCm38)	D445H	probably damaging	Het
Igfn1	T	C	1: 135,997,848 (GRCm38)	D56G	probably benign	Het
Igkv11-125	T	C	6: 67,913,871 (GRCm38)	F58L	possibly damaging	Het
Klhdc4	A	C	8: 121,821,334 (GRCm38)	H72Q	probably damaging	Het
Kmt2c	A	G	5: 25,275,735 (GRCm38)	Y1459H	probably damaging	Het
Lama2	C	T	10: 27,001,235 (GRCm38)	E2652K	probably benign	Het
Muc5b	C	T	7: 141,858,759 (GRCm38)	T1814M	unknown	Het
Ntrk3	C	T	7: 78,460,515 (GRCm38)	V324M	probably benign	Het
Olfr591	T	A	7: 103,173,086 (GRCm38)	M184L	probably damaging	Het
Per2	A	T	1: 91,445,575 (GRCm38)	C164S	probably benign	Het
Rbl2	T	A	8: 91,102,235 (GRCm38)	I588N	probably benign	Het
Rslcan18	C	T	13: 67,098,607 (GRCm38)	E314K	possibly damaging	Het
Ubr3	A	T	2: 69,988,840 (GRCm38)	T1325S	probably damaging	Het
Unc45a	A	G	7: 80,331,546 (GRCm38)		probably benign	Het
Vmn1r175	A	G	7: 23,808,968 (GRCm38)	V78A	probably benign	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116,841,388 (GRCm38)	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116,900,987 (GRCm38)	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116,873,697 (GRCm38)	splice site	probably benign
IGL02339:Ptprn2	APN	12	116,722,104 (GRCm38)	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116,888,898 (GRCm38)	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117,211,943 (GRCm38)	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116,876,344 (GRCm38)	nonsense	probably null
BB001:Ptprn2	UTSW	12	116,841,264 (GRCm38)	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116,841,264 (GRCm38)	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117,248,688 (GRCm38)	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117,276,602 (GRCm38)	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117,276,602 (GRCm38)	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117,211,846 (GRCm38)	splice site	probably benign
R0131:Ptprn2	UTSW	12	116,722,091 (GRCm38)	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116,722,091 (GRCm38)	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116,722,091 (GRCm38)	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117,211,846 (GRCm38)	splice site	probably benign
R0694:Ptprn2	UTSW	12	116,824,355 (GRCm38)	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116,722,130 (GRCm38)	nonsense	probably null
R0746:Ptprn2	UTSW	12	116,901,017 (GRCm38)	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117,212,008 (GRCm38)	splice site	probably null
R1443:Ptprn2	UTSW	12	117,253,615 (GRCm38)	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117,184,722 (GRCm38)	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117,161,709 (GRCm38)	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116,722,172 (GRCm38)	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116,580,428 (GRCm38)	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117,247,717 (GRCm38)	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116,722,133 (GRCm38)	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116,876,180 (GRCm38)	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116,888,877 (GRCm38)	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116,901,008 (GRCm38)	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116,876,000 (GRCm38)	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116,872,094 (GRCm38)	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116,824,396 (GRCm38)	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117,247,773 (GRCm38)	nonsense	probably null
R4872:Ptprn2	UTSW	12	117,161,694 (GRCm38)	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117,233,365 (GRCm38)	splice site	probably null
R4970:Ptprn2	UTSW	12	117,276,595 (GRCm38)	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116,858,928 (GRCm38)	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117,211,862 (GRCm38)	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117,184,647 (GRCm38)	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117,255,595 (GRCm38)	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117,255,595 (GRCm38)	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116,859,119 (GRCm38)	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116,876,180 (GRCm38)	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117,269,589 (GRCm38)	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116,872,038 (GRCm38)	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117,227,200 (GRCm38)	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116,888,888 (GRCm38)	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116,872,056 (GRCm38)	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117,227,225 (GRCm38)	splice site	probably null
R7237:Ptprn2	UTSW	12	117,161,727 (GRCm38)	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117,248,544 (GRCm38)	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116,858,951 (GRCm38)	missense	probably benign
R7460:Ptprn2	UTSW	12	117,248,681 (GRCm38)	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116,485,866 (GRCm38)	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116,722,119 (GRCm38)	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116,841,320 (GRCm38)	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116,841,264 (GRCm38)	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117,184,737 (GRCm38)	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117,255,548 (GRCm38)	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117,269,651 (GRCm38)	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117,161,658 (GRCm38)	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117,184,740 (GRCm38)	missense	probably benign	0.16
X0066:Ptprn2	UTSW	12	117,161,760 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGTCATCTCATGGGTGTTTC -3'
(R):5'- GGATGTATCCCTGCTGTTCC -3'

Sequencing Primer
(F):5'- GTTAGGTCAACCGTCTGAGC -3'
(R):5'- TGTTCCTCAGAAGGCTGCAC -3'

Posted On

2015-02-05