Incidental Mutation 'R3112:Phactr3'
ID 263722
Institutional Source Beutler Lab
Gene Symbol Phactr3
Ensembl Gene ENSMUSG00000027525
Gene Name phosphatase and actin regulator 3
Synonyms 4930415A02Rik, 1500003N10Rik, scapinin
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R3112 (G1)
Quality Score 201
Status Validated
Chromosome 2
Chromosomal Location 178118975-178338492 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 178279017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 180 (L180Q)
Ref Sequence ENSEMBL: ENSMUSP00000099354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103065] [ENSMUST00000103066] [ENSMUST00000108915] [ENSMUST00000108916] [ENSMUST00000108917]
AlphaFold Q8BYK5
Predicted Effect possibly damaging
Transcript: ENSMUST00000103065
AA Change: L180Q

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099354
Gene: ENSMUSG00000027525
AA Change: L180Q

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
RPEL 52 77 2.08e0 SMART
low complexity region 187 206 N/A INTRINSIC
RPEL 360 385 5.1e-4 SMART
low complexity region 387 397 N/A INTRINSIC
RPEL 398 423 3.24e-6 SMART
RPEL 436 461 9.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103066
AA Change: L220Q

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099355
Gene: ENSMUSG00000027525
AA Change: L220Q

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
RPEL 92 117 2.08e0 SMART
low complexity region 227 246 N/A INTRINSIC
RPEL 400 425 5.1e-4 SMART
low complexity region 427 437 N/A INTRINSIC
RPEL 438 463 3.24e-6 SMART
RPEL 476 501 9.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108915
AA Change: L221Q

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104543
Gene: ENSMUSG00000027525
AA Change: L221Q

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
RPEL 93 118 2.08e0 SMART
low complexity region 228 247 N/A INTRINSIC
RPEL 401 426 5.1e-4 SMART
low complexity region 428 438 N/A INTRINSIC
RPEL 439 464 3.24e-6 SMART
RPEL 477 502 9.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108916
AA Change: L216Q

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104544
Gene: ENSMUSG00000027525
AA Change: L216Q

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 434 459 3.24e-6 SMART
RPEL 472 497 9.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108917
AA Change: L216Q

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104545
Gene: ENSMUSG00000027525
AA Change: L216Q

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 436 458 2.74e-4 SMART
RPEL 471 496 9.82e-6 SMART
Meta Mutation Damage Score 0.0806 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator protein family. The encoded protein is associated with the nuclear scaffold in proliferating cells, and binds to actin and the catalytic subunit of protein phosphatase-1, suggesting that it functions as a regulatory subunit of protein phosphatase-1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Phactr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Phactr3 APN 2 178279062 missense probably benign 0.00
IGL01432:Phactr3 APN 2 178283100 missense probably benign 0.05
IGL01580:Phactr3 APN 2 178269504 splice site probably benign
IGL02688:Phactr3 APN 2 178278999 missense probably damaging 0.96
IGL02985:Phactr3 APN 2 178175457 missense probably benign
PIT4151001:Phactr3 UTSW 2 178334068 missense probably damaging 1.00
R1854:Phactr3 UTSW 2 178283147 missense probably damaging 1.00
R2132:Phactr3 UTSW 2 178283966 missense probably benign 0.14
R3110:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3122:Phactr3 UTSW 2 178331618 missense probably damaging 1.00
R4193:Phactr3 UTSW 2 178283152 missense probably damaging 0.98
R4194:Phactr3 UTSW 2 178283109 missense possibly damaging 0.80
R4243:Phactr3 UTSW 2 178283189 splice site probably null
R4245:Phactr3 UTSW 2 178283189 splice site probably null
R4397:Phactr3 UTSW 2 178175406 intron probably benign
R4433:Phactr3 UTSW 2 178283132 missense probably damaging 1.00
R4581:Phactr3 UTSW 2 178283172 missense probably damaging 1.00
R4772:Phactr3 UTSW 2 178283936 missense probably damaging 1.00
R4830:Phactr3 UTSW 2 178284018 missense probably damaging 0.98
R5045:Phactr3 UTSW 2 178331619 missense probably damaging 1.00
R5442:Phactr3 UTSW 2 178142461 missense probably benign 0.38
R5461:Phactr3 UTSW 2 178278901 missense probably benign
R5816:Phactr3 UTSW 2 178302793 missense probably damaging 1.00
R6276:Phactr3 UTSW 2 178279019 missense probably damaging 0.99
R6668:Phactr3 UTSW 2 178332864 missense probably damaging 1.00
R7144:Phactr3 UTSW 2 178302736 missense probably damaging 1.00
R7340:Phactr3 UTSW 2 178334061 missense probably damaging 1.00
R7798:Phactr3 UTSW 2 178283910 missense probably benign 0.19
R8009:Phactr3 UTSW 2 178332944 missense probably damaging 1.00
R8074:Phactr3 UTSW 2 178302796 missense probably damaging 1.00
R8348:Phactr3 UTSW 2 178256142 missense probably benign 0.03
R8530:Phactr3 UTSW 2 178284026 missense probably damaging 1.00
R9153:Phactr3 UTSW 2 178283946 missense possibly damaging 0.79
R9406:Phactr3 UTSW 2 178284063 missense probably damaging 0.99
Z1176:Phactr3 UTSW 2 178269374 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGATCAGTGTCTTCCCACC -3'
(R):5'- TGCTGAGGCAATGACAAGAGTC -3'

Sequencing Primer
(F):5'- GATCAGTGTCTTCCCACCATCAAG -3'
(R):5'- CAAGAGTCAGCCTGGAGC -3'
Posted On 2015-02-05