Incidental Mutation 'R3112:Pcmtd2'
ID 263723
Institutional Source Beutler Lab
Gene Symbol Pcmtd2
Ensembl Gene ENSMUSG00000027589
Gene Name protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R3112 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 181837854-181857461 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181855129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 300 (I300F)
Ref Sequence ENSEMBL: ENSMUSP00000029116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029116] [ENSMUST00000108754]
AlphaFold Q8BHD8
Predicted Effect probably damaging
Transcript: ENSMUST00000029116
AA Change: I300F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029116
Gene: ENSMUSG00000027589
AA Change: I300F

DomainStartEndE-ValueType
Pfam:PCMT 9 224 1e-28 PFAM
low complexity region 277 284 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
low complexity region 341 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108754
SMART Domains Protein: ENSMUSP00000104385
Gene: ENSMUSG00000027589

DomainStartEndE-ValueType
Pfam:PCMT 9 215 2.1e-28 PFAM
Pfam:DOT1 58 158 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122811
Predicted Effect probably benign
Transcript: ENSMUST00000124346
SMART Domains Protein: ENSMUSP00000115743
Gene: ENSMUSG00000027589

DomainStartEndE-ValueType
Pfam:PCMT 8 103 4.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145475
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Pcmtd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2377:Pcmtd2 UTSW 2 181855279 utr 3 prime probably benign
R3110:Pcmtd2 UTSW 2 181855129 missense probably damaging 0.98
R3111:Pcmtd2 UTSW 2 181855129 missense probably damaging 0.98
R4571:Pcmtd2 UTSW 2 181842424 missense possibly damaging 0.65
R5108:Pcmtd2 UTSW 2 181844423 missense probably damaging 1.00
R5137:Pcmtd2 UTSW 2 181854994 missense possibly damaging 0.87
R5778:Pcmtd2 UTSW 2 181855198 missense probably benign 0.00
R5861:Pcmtd2 UTSW 2 181842475 missense probably damaging 0.96
R6841:Pcmtd2 UTSW 2 181844438 missense probably damaging 0.99
R7063:Pcmtd2 UTSW 2 181854983 nonsense probably null
R7407:Pcmtd2 UTSW 2 181846605 missense possibly damaging 0.83
R7706:Pcmtd2 UTSW 2 181855075 missense probably damaging 1.00
R7747:Pcmtd2 UTSW 2 181851659 missense possibly damaging 0.91
R7769:Pcmtd2 UTSW 2 181851701 missense probably benign 0.00
R7896:Pcmtd2 UTSW 2 181854983 missense probably damaging 1.00
R8939:Pcmtd2 UTSW 2 181855070 utr 3 prime probably benign
R9433:Pcmtd2 UTSW 2 181855044 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GTCCTTTCAGCAAGTTAGATGTGG -3'
(R):5'- TGTACCTGGCCAGCAGTTTC -3'

Sequencing Primer
(F):5'- CAGCAAGTTAGATGTGGGTTGGC -3'
(R):5'- CACTTTTCCCTGTAATACAGCAGG -3'
Posted On 2015-02-05