Incidental Mutation 'R3112:Prpf3'
ID263725
Institutional Source Beutler Lab
Gene Symbol Prpf3
Ensembl Gene ENSMUSG00000015748
Gene Namepre-mRNA processing factor 3
Synonyms
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3112 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95830124-95855885 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 95849800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015892] [ENSMUST00000160109] [ENSMUST00000161476]
Predicted Effect probably benign
Transcript: ENSMUST00000015892
SMART Domains Protein: ENSMUSP00000015892
Gene: ENSMUSG00000015748

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 308 521 1.3e-82 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 544 673 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160109
SMART Domains Protein: ENSMUSP00000124302
Gene: ENSMUSG00000015748

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161420
Predicted Effect probably benign
Transcript: ENSMUST00000161476
SMART Domains Protein: ENSMUSP00000124950
Gene: ENSMUSG00000015748

DomainStartEndE-ValueType
PWI 3 76 5.99e-29 SMART
low complexity region 112 135 N/A INTRINSIC
Pfam:PRP3 307 522 5.4e-74 PFAM
low complexity region 526 534 N/A INTRINSIC
Pfam:DUF1115 543 674 3.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161482
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Prpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02175:Prpf3 APN 3 95834107 missense probably damaging 0.99
IGL02825:Prpf3 APN 3 95853480 missense probably damaging 1.00
R0940:Prpf3 UTSW 3 95844223 missense probably damaging 1.00
R1542:Prpf3 UTSW 3 95836470 missense probably benign 0.08
R1545:Prpf3 UTSW 3 95847803 missense probably damaging 0.99
R2063:Prpf3 UTSW 3 95844239 missense probably benign
R2084:Prpf3 UTSW 3 95848989 missense probably benign 0.44
R2160:Prpf3 UTSW 3 95845230 missense probably benign 0.19
R3110:Prpf3 UTSW 3 95849800 intron probably benign
R4636:Prpf3 UTSW 3 95834170 missense probably damaging 0.99
R4671:Prpf3 UTSW 3 95851664 missense possibly damaging 0.76
R4689:Prpf3 UTSW 3 95836489 nonsense probably null
R4702:Prpf3 UTSW 3 95834092 missense probably damaging 0.97
R5080:Prpf3 UTSW 3 95833797 missense probably benign 0.45
R5177:Prpf3 UTSW 3 95849724 intron probably benign
R5290:Prpf3 UTSW 3 95853545 missense probably benign 0.39
R5397:Prpf3 UTSW 3 95853579 missense probably benign 0.09
R6329:Prpf3 UTSW 3 95832578 missense probably damaging 1.00
R7133:Prpf3 UTSW 3 95833740 splice site probably null
R8433:Prpf3 UTSW 3 95851651 missense probably damaging 1.00
R8725:Prpf3 UTSW 3 95840709 missense possibly damaging 0.48
X0063:Prpf3 UTSW 3 95840715 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTCAAGCAAATTTCATTCCCATG -3'
(R):5'- AGTACATGCTGCTGTGAAGG -3'

Sequencing Primer
(F):5'- CCAGAAAAGAGGCTTGTTCTTG -3'
(R):5'- CATGCTGCTGTGAAGGCCAAG -3'
Posted On2015-02-05