Incidental Mutation 'R3112:Cdc7'
ID263728
Institutional Source Beutler Lab
Gene Symbol Cdc7
Ensembl Gene ENSMUSG00000029283
Gene Namecell division cycle 7 (S. cerevisiae)
SynonymsCdc7, muCdc7, Cdc7l1
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3112 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106964322-106984432 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 106974698 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031221] [ENSMUST00000076467] [ENSMUST00000117196] [ENSMUST00000118261] [ENSMUST00000129938]
Predicted Effect probably null
Transcript: ENSMUST00000031221
SMART Domains Protein: ENSMUSP00000031221
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 212 1.7e-14 PFAM
Pfam:Pkinase 52 216 4.4e-27 PFAM
Pfam:Pkinase 351 559 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076467
SMART Domains Protein: ENSMUSP00000075792
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.7e-14 PFAM
Pfam:Pkinase 52 227 1.1e-25 PFAM
Pfam:Pkinase 314 520 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117196
SMART Domains Protein: ENSMUSP00000112392
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1e-14 PFAM
Pfam:Pkinase 52 227 6.6e-26 PFAM
Pfam:Pkinase 313 527 4.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118261
SMART Domains Protein: ENSMUSP00000113385
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.2e-14 PFAM
Pfam:Pkinase 52 227 7.4e-26 PFAM
Pfam:Pkinase 345 559 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123546
Predicted Effect probably benign
Transcript: ENSMUST00000129938
SMART Domains Protein: ENSMUSP00000119612
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 5.4e-15 PFAM
Pfam:Pkinase 52 227 3.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199223
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5-E6.5. In conjunction with a Trp53-null allele, double homozygous mutant embryos survive up to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Cdc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Cdc7 APN 5 106968860 missense probably benign
IGL01671:Cdc7 APN 5 106983245 missense probably damaging 1.00
IGL03373:Cdc7 APN 5 106972919 splice site probably benign
R0179:Cdc7 UTSW 5 106965039 missense probably benign 0.02
R0563:Cdc7 UTSW 5 106972910 splice site probably benign
R1621:Cdc7 UTSW 5 106965054 missense probably benign
R1970:Cdc7 UTSW 5 106973074 splice site probably benign
R2044:Cdc7 UTSW 5 106983132 missense probably benign
R2993:Cdc7 UTSW 5 106973898 missense probably benign
R3110:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R4700:Cdc7 UTSW 5 106973841 missense probably benign 0.00
R5396:Cdc7 UTSW 5 106969297 splice site probably null
R6217:Cdc7 UTSW 5 106972794 missense probably damaging 1.00
R6258:Cdc7 UTSW 5 106969227 missense probably damaging 1.00
R6285:Cdc7 UTSW 5 106983059 missense probably benign 0.00
R6609:Cdc7 UTSW 5 106973058 missense probably benign 0.04
R7828:Cdc7 UTSW 5 106972950 missense possibly damaging 0.67
R8518:Cdc7 UTSW 5 106972998 missense probably damaging 1.00
V8831:Cdc7 UTSW 5 106968910 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAAAACTGTGGCAGAGGAC -3'
(R):5'- CATGGTGAAGTCTAGCCTTGTTC -3'

Sequencing Primer
(F):5'- CAGCTGGCAGAAAGTGTTAC -3'
(R):5'- GAAGTCTAGCCTTGTTCTGAAATG -3'
Posted On2015-02-05