Incidental Mutation 'R3112:Olr1'
ID 263735
Institutional Source Beutler Lab
Gene Symbol Olr1
Ensembl Gene ENSMUSG00000030162
Gene Name oxidized low density lipoprotein (lectin-like) receptor 1
Synonyms LOX-1, Scare1, SR-EI
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3112 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 129485244-129507165 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129499918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 128 (N128S)
Ref Sequence ENSEMBL: ENSMUSP00000032265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032265] [ENSMUST00000162815] [ENSMUST00000182784] [ENSMUST00000183258]
AlphaFold Q9EQ09
Predicted Effect possibly damaging
Transcript: ENSMUST00000032265
AA Change: N128S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032265
Gene: ENSMUSG00000030162
AA Change: N128S

DomainStartEndE-ValueType
Blast:CLECT 45 186 4e-13 BLAST
low complexity region 202 226 N/A INTRINSIC
CLECT 235 355 3.83e-21 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162815
AA Change: N94S
SMART Domains Protein: ENSMUSP00000124660
Gene: ENSMUSG00000030162
AA Change: N94S

DomainStartEndE-ValueType
Blast:CLECT 24 75 1e-8 BLAST
low complexity region 76 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182784
SMART Domains Protein: ENSMUSP00000138588
Gene: ENSMUSG00000030162

DomainStartEndE-ValueType
CLECT 61 181 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183258
SMART Domains Protein: ENSMUSP00000138228
Gene: ENSMUSG00000030162

DomainStartEndE-ValueType
CLECT 27 147 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203564
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Olr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Olr1 APN 6 129493523 missense probably benign 0.02
IGL01751:Olr1 APN 6 129488848 missense possibly damaging 0.62
IGL02308:Olr1 APN 6 129499897 missense possibly damaging 0.70
IGL03120:Olr1 APN 6 129488935 missense probably damaging 0.97
IGL03237:Olr1 APN 6 129502154 missense probably damaging 1.00
ANU74:Olr1 UTSW 6 129500069 missense possibly damaging 0.91
PIT4618001:Olr1 UTSW 6 129499906 missense probably damaging 0.99
R0112:Olr1 UTSW 6 129488906 missense possibly damaging 0.77
R1375:Olr1 UTSW 6 129507076 missense possibly damaging 0.94
R1650:Olr1 UTSW 6 129507089 missense probably benign 0.29
R1828:Olr1 UTSW 6 129488932 missense possibly damaging 0.94
R1971:Olr1 UTSW 6 129493535 missense probably benign 0.06
R2074:Olr1 UTSW 6 129502094 missense probably benign 0.23
R3110:Olr1 UTSW 6 129499918 missense possibly damaging 0.91
R3735:Olr1 UTSW 6 129499875 unclassified probably benign
R3736:Olr1 UTSW 6 129499875 unclassified probably benign
R4200:Olr1 UTSW 6 129502105 missense probably damaging 0.98
R4780:Olr1 UTSW 6 129488876 missense probably damaging 0.99
R4801:Olr1 UTSW 6 129488090 missense possibly damaging 0.71
R4802:Olr1 UTSW 6 129488090 missense possibly damaging 0.71
R4856:Olr1 UTSW 6 129493596 nonsense probably null
R4929:Olr1 UTSW 6 129500081 missense probably damaging 1.00
R5148:Olr1 UTSW 6 129493609 missense probably benign 0.02
R5659:Olr1 UTSW 6 129500029 missense probably damaging 0.96
R6037:Olr1 UTSW 6 129493541 missense probably damaging 1.00
R6037:Olr1 UTSW 6 129493541 missense probably damaging 1.00
R6116:Olr1 UTSW 6 129499984 missense probably damaging 1.00
R6356:Olr1 UTSW 6 129493559 missense probably benign 0.22
R6676:Olr1 UTSW 6 129500077 splice site probably null
R7001:Olr1 UTSW 6 129488111 missense probably damaging 1.00
R7056:Olr1 UTSW 6 129488941 missense probably damaging 1.00
R9169:Olr1 UTSW 6 129493565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTACGCCCATGAGAAGG -3'
(R):5'- AGCGAACCTTACTCAGCAG -3'

Sequencing Primer
(F):5'- TATGCTTCCCCTGGGCTAGAAG -3'
(R):5'- GAACCTTACTCAGCAGGATCGTATC -3'
Posted On 2015-02-05