Mutagenetix > Incidental Mutation

Incidental Mutation 'R3112:Tas2r120'

263736

Institutional Source

Beutler Lab

Gene Symbol

Tas2r120

Ensembl Gene

ENSMUSG00000059382

Gene Name

taste receptor, type 2, member 120

Synonyms

mt2r47, mGR20, Tas2r20, T2R20

MMRRC Submission

040585-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.048) question?

Stock #

R3112 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

132656953-132657844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 132657768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 271 (H271L)

Ref Sequence

ENSEMBL: ENSMUSP00000071626 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071707]

AlphaFold

Q7M721

Predicted Effect

probably damaging
Transcript: ENSMUST00000071707
AA Change: H271L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071626
Gene: ENSMUSG00000059382
AA Change: H271L

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	294	2.4e-77	PFAM

Meta Mutation Damage Score

0.5465

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAS2R46 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). For further information on TAS2Rs, see MIM 604791.[supplied by OMIM, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	G	2: 111,228,054	L131F	probably damaging	Het
Abca6	T	A	11: 110,178,829	K1554*	probably null	Het
Acads	T	C	5: 115,117,698	H26R	probably benign	Het
Acer1	G	A	17: 56,958,406	T141I	probably damaging	Het
Adam15	C	G	3: 89,347,457	V99L	probably benign	Het
Ankrd13b	A	G	11: 77,477,505	V97A	possibly damaging	Het
Anpep	T	C	7: 79,841,972	T94A	probably benign	Het
Atp1a3	T	C	7: 24,994,694	N345S	probably damaging	Het
Btn1a1	T	A	13: 23,461,551	N216I	possibly damaging	Het
Cacna1s	G	A	1: 136,075,093	W62*	probably null	Het
Ccdc141	C	T	2: 77,039,486	V892I	probably benign	Het
Ccdc180	T	A	4: 45,900,470	I278K	possibly damaging	Het
Cdc7	T	G	5: 106,974,698		probably null	Het
Cpb1	C	T	3: 20,265,357	V188M	probably damaging	Het
Dock5	A	G	14: 67,857,922	I101T	possibly damaging	Het
Dqx1	T	C	6: 83,058,972	V95A	probably damaging	Het
Dvl1	T	A	4: 155,853,666	D90E	probably damaging	Het
Fam135b	T	C	15: 71,464,030	I438M	probably benign	Het
Fam57a	A	G	11: 76,202,231	D33G	probably benign	Het
Fpr1	A	T	17: 17,876,635	M364K	probably benign	Het
Gm14139	C	G	2: 150,192,221	P185R	probably damaging	Het
Gm7030	T	C	17: 36,129,146	Y32C	probably damaging	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gpx7	C	A	4: 108,403,273	V109F	probably damaging	Het
Grhl2	T	C	15: 37,336,347		probably null	Het
Grn	A	G	11: 102,433,243	T53A	probably benign	Het
Hist1h1e	T	C	13: 23,621,846		probably benign	Het
Hmgxb3	T	C	18: 61,147,382	N683S	probably damaging	Het
Iigp1	T	C	18: 60,390,911	I367T	probably benign	Het
Itfg2	T	C	6: 128,411,669	E285G	probably damaging	Het
Itgav	T	A	2: 83,792,571	C662*	probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Lipe	T	C	7: 25,398,423	T32A	probably benign	Het
Lrrk2	A	G	15: 91,814,695	Y2475C	probably benign	Het
Mcc	T	C	18: 44,449,263	D607G	probably damaging	Het
Mip	T	A	10: 128,226,006	L42*	probably null	Het
Mlc1	A	T	15: 88,965,996	D192E	probably benign	Het
Muc2	T	C	7: 141,745,488		probably benign	Het
Mybl1	T	C	1: 9,681,870	D260G	probably damaging	Het
Ncln	C	T	10: 81,487,685	V51I	probably benign	Het
Nlrp9a	T	C	7: 26,557,872	V305A	probably benign	Het
Nodal	G	A	10: 61,424,497	R309Q	possibly damaging	Het
Olfr1338	A	T	4: 118,754,224	F105I	probably damaging	Het
Olfr294	T	C	7: 86,615,676	Y323C	probably benign	Het
Olfr536	A	G	7: 140,503,919	I180T	probably damaging	Het
Olr1	T	C	6: 129,499,918	N128S	possibly damaging	Het
Orc1	T	A	4: 108,604,560	C585S	probably benign	Het
Pcmtd2	A	T	2: 181,855,129	I300F	probably damaging	Het
Pfkfb4	C	T	9: 109,025,042		probably benign	Het
Phactr3	T	A	2: 178,279,017	L180Q	possibly damaging	Het
Pigo	T	C	4: 43,021,083	T612A	probably benign	Het
Plch1	T	A	3: 63,709,531	D766V	probably damaging	Het
Plekhh3	T	C	11: 101,164,147		probably benign	Het
Ppp1r12b	T	A	1: 134,872,832	T547S	probably damaging	Het
Prkcb	T	A	7: 122,516,856	M186K	probably damaging	Het
Prpf3	A	T	3: 95,849,800		probably benign	Het
Psg23	T	C	7: 18,610,444	D362G	possibly damaging	Het
Reg3a	T	C	6: 78,381,131	L15P	probably damaging	Het
Scrib	A	T	15: 76,069,374	I5N	probably damaging	Het
Speg	C	T	1: 75,422,682	Q2005*	probably null	Het
Sppl3	A	T	5: 115,074,864	S51C	possibly damaging	Het
Sspo	A	G	6: 48,457,600	T1009A	probably damaging	Het
Syce1l	A	G	8: 113,654,947	Q164R	probably benign	Het
Sympk	T	C	7: 19,034,484	V126A	possibly damaging	Het
Tas2r110	T	A	6: 132,868,024	I6K	unknown	Het
Tnn	T	A	1: 160,116,286	T986S	possibly damaging	Het
Trim5	T	C	7: 104,279,638	H32R	probably damaging	Het
Ttc13	A	G	8: 124,683,834	I360T	possibly damaging	Het
Uaca	A	G	9: 60,871,499	E1054G	probably damaging	Het
Usp16	T	A	16: 87,471,848		probably null	Het
Wee1	T	A	7: 110,130,836	S382R	probably damaging	Het
Wnt11	T	C	7: 98,846,564	S92P	probably damaging	Het
Zfp786	A	G	6: 47,820,226	C593R	probably damaging	Het
Zfp879	T	G	11: 50,833,162	I283L	possibly damaging	Het

Other mutations in Tas2r120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Tas2r120	APN	6	132657275	missense	probably benign	0.01
IGL01725:Tas2r120	APN	6	132657089	nonsense	probably null
IGL01860:Tas2r120	APN	6	132657264	missense	probably damaging	0.99
IGL01891:Tas2r120	APN	6	132657844	makesense	probably null
PIT4519001:Tas2r120	UTSW	6	132657334	missense	probably benign
R0104:Tas2r120	UTSW	6	132657846	splice site	probably null
R0108:Tas2r120	UTSW	6	132657846	splice site	probably null
R0123:Tas2r120	UTSW	6	132657589	nonsense	probably null
R0225:Tas2r120	UTSW	6	132657589	nonsense	probably null
R1812:Tas2r120	UTSW	6	132657601	missense	probably benign	0.02
R2254:Tas2r120	UTSW	6	132657609	missense	probably benign
R3110:Tas2r120	UTSW	6	132657768	missense	probably damaging	1.00
R4829:Tas2r120	UTSW	6	132657368	missense	probably benign	0.03
R5248:Tas2r120	UTSW	6	132657147	missense	probably damaging	0.97
R5372:Tas2r120	UTSW	6	132657483	missense	possibly damaging	0.54
R6379:Tas2r120	UTSW	6	132657810	missense	probably benign	0.00
R7015:Tas2r120	UTSW	6	132657165	missense	possibly damaging	0.48
R7615:Tas2r120	UTSW	6	132657810	missense	probably benign	0.00
R8004:Tas2r120	UTSW	6	132657427	missense	possibly damaging	0.82
R8796:Tas2r120	UTSW	6	132657118	missense	probably damaging	1.00
R9207:Tas2r120	UTSW	6	132657663	nonsense	probably null
R9250:Tas2r120	UTSW	6	132656991	missense	probably benign	0.02
R9792:Tas2r120	UTSW	6	132657565	missense	possibly damaging	0.93
Z1176:Tas2r120	UTSW	6	132657185	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGATGTCAAGATCAGAGCACC -3'
(R):5'- GGGACAATTCATTGCCCTTATAATG -3'

Sequencing Primer
(F):5'- TGTCAAGATCAGAGCACCATGGTC -3'
(R):5'- CAATAGCCTAAAAGGGGTAAAATCTG -3'

Posted On

2015-02-05