Mutagenetix > Incidental Mutation

Incidental Mutation 'R3112:Anpep'

263739

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

040585-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3112 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79841972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 94 (T94A)

Ref Sequence

ENSEMBL: ENSMUSP00000103015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]

AlphaFold

P97449

Predicted Effect

probably benign
Transcript: ENSMUST00000049004
AA Change: T94A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: T94A

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107392
AA Change: T94A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: T94A

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149164

Predicted Effect

probably benign
Transcript: ENSMUST00000205502

Predicted Effect

probably benign
Transcript: ENSMUST00000206235

Meta Mutation Damage Score

0.1101

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	G	2: 111,228,054	L131F	probably damaging	Het
Abca6	T	A	11: 110,178,829	K1554*	probably null	Het
Acads	T	C	5: 115,117,698	H26R	probably benign	Het
Acer1	G	A	17: 56,958,406	T141I	probably damaging	Het
Adam15	C	G	3: 89,347,457	V99L	probably benign	Het
Ankrd13b	A	G	11: 77,477,505	V97A	possibly damaging	Het
Atp1a3	T	C	7: 24,994,694	N345S	probably damaging	Het
Btn1a1	T	A	13: 23,461,551	N216I	possibly damaging	Het
Cacna1s	G	A	1: 136,075,093	W62*	probably null	Het
Ccdc141	C	T	2: 77,039,486	V892I	probably benign	Het
Ccdc180	T	A	4: 45,900,470	I278K	possibly damaging	Het
Cdc7	T	G	5: 106,974,698		probably null	Het
Cpb1	C	T	3: 20,265,357	V188M	probably damaging	Het
Dock5	A	G	14: 67,857,922	I101T	possibly damaging	Het
Dqx1	T	C	6: 83,058,972	V95A	probably damaging	Het
Dvl1	T	A	4: 155,853,666	D90E	probably damaging	Het
Fam135b	T	C	15: 71,464,030	I438M	probably benign	Het
Fam57a	A	G	11: 76,202,231	D33G	probably benign	Het
Fpr1	A	T	17: 17,876,635	M364K	probably benign	Het
Gm14139	C	G	2: 150,192,221	P185R	probably damaging	Het
Gm7030	T	C	17: 36,129,146	Y32C	probably damaging	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gpx7	C	A	4: 108,403,273	V109F	probably damaging	Het
Grhl2	T	C	15: 37,336,347		probably null	Het
Grn	A	G	11: 102,433,243	T53A	probably benign	Het
Hist1h1e	T	C	13: 23,621,846		probably benign	Het
Hmgxb3	T	C	18: 61,147,382	N683S	probably damaging	Het
Iigp1	T	C	18: 60,390,911	I367T	probably benign	Het
Itfg2	T	C	6: 128,411,669	E285G	probably damaging	Het
Itgav	T	A	2: 83,792,571	C662*	probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Lipe	T	C	7: 25,398,423	T32A	probably benign	Het
Lrrk2	A	G	15: 91,814,695	Y2475C	probably benign	Het
Mcc	T	C	18: 44,449,263	D607G	probably damaging	Het
Mip	T	A	10: 128,226,006	L42*	probably null	Het
Mlc1	A	T	15: 88,965,996	D192E	probably benign	Het
Muc2	T	C	7: 141,745,488		probably benign	Het
Mybl1	T	C	1: 9,681,870	D260G	probably damaging	Het
Ncln	C	T	10: 81,487,685	V51I	probably benign	Het
Nlrp9a	T	C	7: 26,557,872	V305A	probably benign	Het
Nodal	G	A	10: 61,424,497	R309Q	possibly damaging	Het
Olfr1338	A	T	4: 118,754,224	F105I	probably damaging	Het
Olfr294	T	C	7: 86,615,676	Y323C	probably benign	Het
Olfr536	A	G	7: 140,503,919	I180T	probably damaging	Het
Olr1	T	C	6: 129,499,918	N128S	possibly damaging	Het
Orc1	T	A	4: 108,604,560	C585S	probably benign	Het
Pcmtd2	A	T	2: 181,855,129	I300F	probably damaging	Het
Pfkfb4	C	T	9: 109,025,042		probably benign	Het
Phactr3	T	A	2: 178,279,017	L180Q	possibly damaging	Het
Pigo	T	C	4: 43,021,083	T612A	probably benign	Het
Plch1	T	A	3: 63,709,531	D766V	probably damaging	Het
Plekhh3	T	C	11: 101,164,147		probably benign	Het
Ppp1r12b	T	A	1: 134,872,832	T547S	probably damaging	Het
Prkcb	T	A	7: 122,516,856	M186K	probably damaging	Het
Prpf3	A	T	3: 95,849,800		probably benign	Het
Psg23	T	C	7: 18,610,444	D362G	possibly damaging	Het
Reg3a	T	C	6: 78,381,131	L15P	probably damaging	Het
Scrib	A	T	15: 76,069,374	I5N	probably damaging	Het
Speg	C	T	1: 75,422,682	Q2005*	probably null	Het
Sppl3	A	T	5: 115,074,864	S51C	possibly damaging	Het
Sspo	A	G	6: 48,457,600	T1009A	probably damaging	Het
Syce1l	A	G	8: 113,654,947	Q164R	probably benign	Het
Sympk	T	C	7: 19,034,484	V126A	possibly damaging	Het
Tas2r110	T	A	6: 132,868,024	I6K	unknown	Het
Tas2r120	A	T	6: 132,657,768	H271L	probably damaging	Het
Tnn	T	A	1: 160,116,286	T986S	possibly damaging	Het
Trim5	T	C	7: 104,279,638	H32R	probably damaging	Het
Ttc13	A	G	8: 124,683,834	I360T	possibly damaging	Het
Uaca	A	G	9: 60,871,499	E1054G	probably damaging	Het
Usp16	T	A	16: 87,471,848		probably null	Het
Wee1	T	A	7: 110,130,836	S382R	probably damaging	Het
Wnt11	T	C	7: 98,846,564	S92P	probably damaging	Het
Zfp786	A	G	6: 47,820,226	C593R	probably damaging	Het
Zfp879	T	G	11: 50,833,162	I283L	possibly damaging	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9042:Anpep	UTSW	7	79838762	missense	probably damaging	0.99
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
R9570:Anpep	UTSW	7	79826913	missense	probably benign	0.00
R9769:Anpep	UTSW	7	79838730	missense	probably damaging	1.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CAGTACGCTCTACCAGTTCC -3'
(R):5'- TCATAGCTCTGTCGGTGGTC -3'

Sequencing Primer
(F):5'- ACCAGTTCCGTTTTGTCAATGTTAG -3'
(R):5'- TGGTCTACGCTCAGGAGAAG -3'

Posted On

2015-02-05