Incidental Mutation 'R3112:Wnt11'
ID 263741
Institutional Source Beutler Lab
Gene Symbol Wnt11
Ensembl Gene ENSMUSG00000015957
Gene Name wingless-type MMTV integration site family, member 11
Synonyms
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock # R3112 (G1)
Quality Score 147
Status Validated
Chromosome 7
Chromosomal Location 98835112-98855195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98846564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 92 (S92P)
Ref Sequence ENSEMBL: ENSMUSP00000132166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067495] [ENSMUST00000163913] [ENSMUST00000165122] [ENSMUST00000165240] [ENSMUST00000167303]
AlphaFold P48615
Predicted Effect probably damaging
Transcript: ENSMUST00000067495
AA Change: S92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064333
Gene: ENSMUSG00000015957
AA Change: S92P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
WNT1 47 354 7.5e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163913
Predicted Effect probably damaging
Transcript: ENSMUST00000165122
AA Change: S92P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125789
Gene: ENSMUSG00000015957
AA Change: S92P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:wnt 44 98 6.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165240
AA Change: S92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131770
Gene: ENSMUSG00000015957
AA Change: S92P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
WNT1 47 149 1.35e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167303
AA Change: S92P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132166
Gene: ENSMUSG00000015957
AA Change: S92P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
WNT1 47 354 7.5e-170 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208062
Meta Mutation Damage Score 0.9045 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 97%, 85%, and 63% amino acid identity with mouse, chicken, and Xenopus Wnt11 protein, respectively. This gene may play roles in the development of skeleton, kidney and lung, and is considered to be a plausible candidate gene for High Bone Mass Syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in extensive embryonic lethality and mutants surviving to birth die within the first 2 days of life. The kidneys are small and exhibit delayed development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Wnt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02889:Wnt11 APN 7 98850359 missense probably damaging 1.00
R0277:Wnt11 UTSW 7 98847383 missense probably damaging 0.99
R0323:Wnt11 UTSW 7 98847383 missense probably damaging 0.99
R0674:Wnt11 UTSW 7 98846528 missense probably damaging 1.00
R3110:Wnt11 UTSW 7 98846564 missense probably damaging 1.00
R5534:Wnt11 UTSW 7 98839142 missense probably damaging 0.98
R5899:Wnt11 UTSW 7 98839176 nonsense probably null
R6481:Wnt11 UTSW 7 98853274 missense probably damaging 1.00
R7198:Wnt11 UTSW 7 98847381 missense possibly damaging 0.87
R9148:Wnt11 UTSW 7 98839034 start gained probably benign
R9301:Wnt11 UTSW 7 98846589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGGCACTGAATCAGAC -3'
(R):5'- GCCTGAAAGCCATATCTAAGATTGAC -3'

Sequencing Primer
(F):5'- TTGGCACTGAATCAGACGCAAC -3'
(R):5'- TCTAAGATTGACTCATCCGCTCAAG -3'
Posted On 2015-02-05