Mutagenetix > Incidental Mutation

Incidental Mutation 'R3112:Prkcb'

263742

Institutional Source

Beutler Lab

Gene Symbol

Prkcb

Ensembl Gene

ENSMUSG00000052889

Gene Name

protein kinase C, beta

Synonyms

Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta

MMRRC Submission

040585-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3112 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122288751-122634402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 122516856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 186 (M186K)

Ref Sequence

ENSEMBL: ENSMUSP00000138788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]

AlphaFold

P68404

Predicted Effect

probably damaging
Transcript: ENSMUST00000064921
AA Change: M186K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: M186K

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	664	9.86e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000064989
AA Change: M186K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: M186K

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143692
AA Change: M186K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: M186K

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

Meta Mutation Damage Score

0.3042

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	G	2: 111,228,054	L131F	probably damaging	Het
Abca6	T	A	11: 110,178,829	K1554*	probably null	Het
Acads	T	C	5: 115,117,698	H26R	probably benign	Het
Acer1	G	A	17: 56,958,406	T141I	probably damaging	Het
Adam15	C	G	3: 89,347,457	V99L	probably benign	Het
Ankrd13b	A	G	11: 77,477,505	V97A	possibly damaging	Het
Anpep	T	C	7: 79,841,972	T94A	probably benign	Het
Atp1a3	T	C	7: 24,994,694	N345S	probably damaging	Het
Btn1a1	T	A	13: 23,461,551	N216I	possibly damaging	Het
Cacna1s	G	A	1: 136,075,093	W62*	probably null	Het
Ccdc141	C	T	2: 77,039,486	V892I	probably benign	Het
Ccdc180	T	A	4: 45,900,470	I278K	possibly damaging	Het
Cdc7	T	G	5: 106,974,698		probably null	Het
Cpb1	C	T	3: 20,265,357	V188M	probably damaging	Het
Dock5	A	G	14: 67,857,922	I101T	possibly damaging	Het
Dqx1	T	C	6: 83,058,972	V95A	probably damaging	Het
Dvl1	T	A	4: 155,853,666	D90E	probably damaging	Het
Fam135b	T	C	15: 71,464,030	I438M	probably benign	Het
Fam57a	A	G	11: 76,202,231	D33G	probably benign	Het
Fpr1	A	T	17: 17,876,635	M364K	probably benign	Het
Gm14139	C	G	2: 150,192,221	P185R	probably damaging	Het
Gm7030	T	C	17: 36,129,146	Y32C	probably damaging	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gpx7	C	A	4: 108,403,273	V109F	probably damaging	Het
Grhl2	T	C	15: 37,336,347		probably null	Het
Grn	A	G	11: 102,433,243	T53A	probably benign	Het
Hist1h1e	T	C	13: 23,621,846		probably benign	Het
Hmgxb3	T	C	18: 61,147,382	N683S	probably damaging	Het
Iigp1	T	C	18: 60,390,911	I367T	probably benign	Het
Itfg2	T	C	6: 128,411,669	E285G	probably damaging	Het
Itgav	T	A	2: 83,792,571	C662*	probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Lipe	T	C	7: 25,398,423	T32A	probably benign	Het
Lrrk2	A	G	15: 91,814,695	Y2475C	probably benign	Het
Mcc	T	C	18: 44,449,263	D607G	probably damaging	Het
Mip	T	A	10: 128,226,006	L42*	probably null	Het
Mlc1	A	T	15: 88,965,996	D192E	probably benign	Het
Muc2	T	C	7: 141,745,488		probably benign	Het
Mybl1	T	C	1: 9,681,870	D260G	probably damaging	Het
Ncln	C	T	10: 81,487,685	V51I	probably benign	Het
Nlrp9a	T	C	7: 26,557,872	V305A	probably benign	Het
Nodal	G	A	10: 61,424,497	R309Q	possibly damaging	Het
Olfr1338	A	T	4: 118,754,224	F105I	probably damaging	Het
Olfr294	T	C	7: 86,615,676	Y323C	probably benign	Het
Olfr536	A	G	7: 140,503,919	I180T	probably damaging	Het
Olr1	T	C	6: 129,499,918	N128S	possibly damaging	Het
Orc1	T	A	4: 108,604,560	C585S	probably benign	Het
Pcmtd2	A	T	2: 181,855,129	I300F	probably damaging	Het
Pfkfb4	C	T	9: 109,025,042		probably benign	Het
Phactr3	T	A	2: 178,279,017	L180Q	possibly damaging	Het
Pigo	T	C	4: 43,021,083	T612A	probably benign	Het
Plch1	T	A	3: 63,709,531	D766V	probably damaging	Het
Plekhh3	T	C	11: 101,164,147		probably benign	Het
Ppp1r12b	T	A	1: 134,872,832	T547S	probably damaging	Het
Prpf3	A	T	3: 95,849,800		probably benign	Het
Psg23	T	C	7: 18,610,444	D362G	possibly damaging	Het
Reg3a	T	C	6: 78,381,131	L15P	probably damaging	Het
Scrib	A	T	15: 76,069,374	I5N	probably damaging	Het
Speg	C	T	1: 75,422,682	Q2005*	probably null	Het
Sppl3	A	T	5: 115,074,864	S51C	possibly damaging	Het
Sspo	A	G	6: 48,457,600	T1009A	probably damaging	Het
Syce1l	A	G	8: 113,654,947	Q164R	probably benign	Het
Sympk	T	C	7: 19,034,484	V126A	possibly damaging	Het
Tas2r110	T	A	6: 132,868,024	I6K	unknown	Het
Tas2r120	A	T	6: 132,657,768	H271L	probably damaging	Het
Tnn	T	A	1: 160,116,286	T986S	possibly damaging	Het
Trim5	T	C	7: 104,279,638	H32R	probably damaging	Het
Ttc13	A	G	8: 124,683,834	I360T	possibly damaging	Het
Uaca	A	G	9: 60,871,499	E1054G	probably damaging	Het
Usp16	T	A	16: 87,471,848		probably null	Het
Wee1	T	A	7: 110,130,836	S382R	probably damaging	Het
Wnt11	T	C	7: 98,846,564	S92P	probably damaging	Het
Zfp786	A	G	6: 47,820,226	C593R	probably damaging	Het
Zfp879	T	G	11: 50,833,162	I283L	possibly damaging	Het

Other mutations in Prkcb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
tilcara	APN	7	122595005	missense	probably damaging	1.00
IGL02045:Prkcb	APN	7	122590167	missense	probably damaging	1.00
IGL02273:Prkcb	APN	7	122627767	missense	probably damaging	1.00
IGL02638:Prkcb	APN	7	122600840	splice site	probably benign
IGL02962:Prkcb	APN	7	122425047	splice site	probably null
IGL03013:Prkcb	APN	7	122627682	missense	probably damaging	1.00
IGL03224:Prkcb	APN	7	122516924	nonsense	probably null
Almonde	UTSW	7	122582449	missense	probably damaging	1.00
Baghdad	UTSW	7	122627663	missense	probably benign	0.07
Mesopotamia	UTSW	7	122289514	missense	probably damaging	1.00
Mosul	UTSW	7	122516844	missense	probably damaging	1.00
tigris	UTSW	7	122424977	missense	probably damaging	1.00
Tikrit	UTSW	7	122627693	missense	probably damaging	1.00
untied	UTSW	7	122582439	missense	possibly damaging	0.90
F5770:Prkcb	UTSW	7	122528476	missense	probably damaging	0.99
R0078:Prkcb	UTSW	7	122590170	missense	probably damaging	1.00
R0409:Prkcb	UTSW	7	122424977	missense	probably damaging	1.00
R0660:Prkcb	UTSW	7	122424959	missense	possibly damaging	0.56
R1462:Prkcb	UTSW	7	122582449	missense	probably damaging	1.00
R1462:Prkcb	UTSW	7	122582449	missense	probably damaging	1.00
R1480:Prkcb	UTSW	7	122594642	missense	probably damaging	1.00
R1518:Prkcb	UTSW	7	122544631	critical splice acceptor site	probably null
R1540:Prkcb	UTSW	7	122627693	missense	probably damaging	1.00
R1860:Prkcb	UTSW	7	122568201	missense	probably damaging	1.00
R3110:Prkcb	UTSW	7	122516856	missense	probably damaging	0.99
R4583:Prkcb	UTSW	7	122457224	missense	probably benign	0.32
R4847:Prkcb	UTSW	7	122568149	missense	probably benign	0.35
R5220:Prkcb	UTSW	7	122289455	missense	probably damaging	1.00
R5487:Prkcb	UTSW	7	122600725	nonsense	probably null
R5599:Prkcb	UTSW	7	122582478	missense	probably benign	0.17
R5946:Prkcb	UTSW	7	122544703	missense	probably benign
R6257:Prkcb	UTSW	7	122568163	missense	probably benign
R6590:Prkcb	UTSW	7	122289514	missense	probably damaging	1.00
R6618:Prkcb	UTSW	7	122627663	missense	probably benign	0.07
R6690:Prkcb	UTSW	7	122289514	missense	probably damaging	1.00
R6763:Prkcb	UTSW	7	122594664	missense	probably damaging	1.00
R7289:Prkcb	UTSW	7	122544687	missense	probably benign	0.04
R7414:Prkcb	UTSW	7	122568227	missense	possibly damaging	0.83
R7466:Prkcb	UTSW	7	122516844	missense	probably damaging	1.00
R7540:Prkcb	UTSW	7	122568134	missense	probably damaging	0.99
R8283:Prkcb	UTSW	7	122600725	nonsense	probably null
R9072:Prkcb	UTSW	7	122528548	missense	probably benign	0.14
R9483:Prkcb	UTSW	7	122582440	missense	probably damaging	0.99
R9670:Prkcb	UTSW	7	122633847	nonsense	probably null
V7581:Prkcb	UTSW	7	122528476	missense	probably damaging	0.99
X0061:Prkcb	UTSW	7	122457306	missense	probably benign	0.03
Z1177:Prkcb	UTSW	7	122568196	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CTGCAATCCTGTCAGGTTGTC -3'
(R):5'- TCCTGGCTAACAATACTGGAAGG -3'

Sequencing Primer
(F):5'- GTCAGGTTGTCTCATTTACATGC -3'
(R):5'- GAGAACGCCCCAGTCCCTATATC -3'

Posted On

2015-02-05