Incidental Mutation 'R3112:Prkcb'
ID 263742
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Name protein kinase C, beta
Synonyms Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
MMRRC Submission 040585-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3112 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 122288751-122634402 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122516856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 186 (M186K)
Ref Sequence ENSEMBL: ENSMUSP00000138788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
AlphaFold P68404
Predicted Effect probably damaging
Transcript: ENSMUST00000064921
AA Change: M186K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: M186K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064989
AA Change: M186K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: M186K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143692
AA Change: M186K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: M186K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Meta Mutation Damage Score 0.3042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122595005 missense probably damaging 1.00
IGL02045:Prkcb APN 7 122590167 missense probably damaging 1.00
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 splice site probably benign
IGL02962:Prkcb APN 7 122425047 splice site probably null
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null
Almonde UTSW 7 122582449 missense probably damaging 1.00
Baghdad UTSW 7 122627663 missense probably benign 0.07
Mesopotamia UTSW 7 122289514 missense probably damaging 1.00
Mosul UTSW 7 122516844 missense probably damaging 1.00
tigris UTSW 7 122424977 missense probably damaging 1.00
Tikrit UTSW 7 122627693 missense probably damaging 1.00
untied UTSW 7 122582439 missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122528476 missense probably damaging 0.99
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5220:Prkcb UTSW 7 122289455 missense probably damaging 1.00
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
R6257:Prkcb UTSW 7 122568163 missense probably benign
R6590:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6618:Prkcb UTSW 7 122627663 missense probably benign 0.07
R6690:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6763:Prkcb UTSW 7 122594664 missense probably damaging 1.00
R7289:Prkcb UTSW 7 122544687 missense probably benign 0.04
R7414:Prkcb UTSW 7 122568227 missense possibly damaging 0.83
R7466:Prkcb UTSW 7 122516844 missense probably damaging 1.00
R7540:Prkcb UTSW 7 122568134 missense probably damaging 0.99
R8283:Prkcb UTSW 7 122600725 nonsense probably null
R9072:Prkcb UTSW 7 122528548 missense probably benign 0.14
R9483:Prkcb UTSW 7 122582440 missense probably damaging 0.99
R9670:Prkcb UTSW 7 122633847 nonsense probably null
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Z1177:Prkcb UTSW 7 122568196 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTGCAATCCTGTCAGGTTGTC -3'
(R):5'- TCCTGGCTAACAATACTGGAAGG -3'

Sequencing Primer
(F):5'- GTCAGGTTGTCTCATTTACATGC -3'
(R):5'- GAGAACGCCCCAGTCCCTATATC -3'
Posted On 2015-02-05