Incidental Mutation 'R3112:Hist1h1e'
ID263751
Institutional Source Beutler Lab
Gene Symbol Hist1h1e
Ensembl Gene ENSMUSG00000051627
Gene Namehistone cluster 1, H1e
SynonymsH1-4, H1var2, H1s-4, H1f4, H1e
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3112 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23620629-23622558 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 23621846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000062045] [ENSMUST00000091704]
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect unknown
Transcript: ENSMUST00000062045
AA Change: K218E
SMART Domains Protein: ENSMUSP00000057308
Gene: ENSMUSG00000051627
AA Change: K218E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
H15 34 99 7.5e-23 SMART
low complexity region 116 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129312
Meta Mutation Damage Score 0.3345 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1e/Hist1h1c double knockout males are significantly smaller than normal. The Hist1h1e/Hist1h1d/Hist1h1e triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Hist1h1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hist1h1e APN 13 23622022 unclassified probably benign
IGL03354:Hist1h1e APN 13 23622077 unclassified probably benign
PIT4469001:Hist1h1e UTSW 13 23622379 missense probably damaging 1.00
R2339:Hist1h1e UTSW 13 23621960 unclassified probably benign
R3110:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3757:Hist1h1e UTSW 13 23622257 nonsense probably null
R3758:Hist1h1e UTSW 13 23622257 nonsense probably null
R5116:Hist1h1e UTSW 13 23622287 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R7008:Hist1h1e UTSW 13 23622209 missense probably damaging 1.00
R7051:Hist1h1e UTSW 13 23622439 missense probably benign 0.00
R7317:Hist1h1e UTSW 13 23622367 missense probably damaging 1.00
R8220:Hist1h1e UTSW 13 23621939 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTTAACACCATTGCGCACAC -3'
(R):5'- CTCAACAAGAAGGCGGCTTC -3'

Sequencing Primer
(F):5'- TTGCGCACACCCACATATC -3'
(R):5'- GCTTCCGGTGAGGCTAAG -3'
Posted On2015-02-05