Mutagenetix > Incidental Mutation

Incidental Mutation 'R3112:Mcc'

263756

Institutional Source

Beutler Lab

Gene Symbol

Mcc

Ensembl Gene

ENSMUSG00000071856

Gene Name

mutated in colorectal cancers

Synonyms

D18Ertd451e

MMRRC Submission

040585-MU

Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3112 (G1)

Quality Score

184

Status

Validated

Chromosome

Chromosomal Location

44425060-44812182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44449263 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 607 (D607G)

Ref Sequence

ENSEMBL: ENSMUSP00000128032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089874] [ENSMUST00000164666]

AlphaFold

E9PWI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000089874
AA Change: D782G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: D782G

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
EFh	24	52	1.36e-3	SMART
EFh	57	85	7.36e0	SMART
coiled coil region	196	308	N/A	INTRINSIC
coiled coil region	395	466	N/A	INTRINSIC
low complexity region	488	493	N/A	INTRINSIC
low complexity region	512	517	N/A	INTRINSIC
low complexity region	523	537	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	577	641	2.6e-32	PFAM
low complexity region	715	731	N/A	INTRINSIC
coiled coil region	738	834	N/A	INTRINSIC
low complexity region	853	863	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	906	972	1.1e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164666
AA Change: D607G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128032
Gene: ENSMUSG00000071856
AA Change: D607G

Domain	Start	End	E-Value	Type
coiled coil region	21	133	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	233	289	1.2e-14	PFAM
low complexity region	313	318	N/A	INTRINSIC
low complexity region	337	342	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	401	467	3.8e-32	PFAM
low complexity region	540	556	N/A	INTRINSIC
coiled coil region	563	659	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC
Pfam:MCC-bdg_PDZ	730	798	1.3e-27	PFAM

Meta Mutation Damage Score

0.1377

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (38/38)

MGI Phenotype

Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	G	2: 111,228,054	L131F	probably damaging	Het
Abca6	T	A	11: 110,178,829	K1554*	probably null	Het
Acads	T	C	5: 115,117,698	H26R	probably benign	Het
Acer1	G	A	17: 56,958,406	T141I	probably damaging	Het
Adam15	C	G	3: 89,347,457	V99L	probably benign	Het
Ankrd13b	A	G	11: 77,477,505	V97A	possibly damaging	Het
Anpep	T	C	7: 79,841,972	T94A	probably benign	Het
Atp1a3	T	C	7: 24,994,694	N345S	probably damaging	Het
Btn1a1	T	A	13: 23,461,551	N216I	possibly damaging	Het
Cacna1s	G	A	1: 136,075,093	W62*	probably null	Het
Ccdc141	C	T	2: 77,039,486	V892I	probably benign	Het
Ccdc180	T	A	4: 45,900,470	I278K	possibly damaging	Het
Cdc7	T	G	5: 106,974,698		probably null	Het
Cpb1	C	T	3: 20,265,357	V188M	probably damaging	Het
Dock5	A	G	14: 67,857,922	I101T	possibly damaging	Het
Dqx1	T	C	6: 83,058,972	V95A	probably damaging	Het
Dvl1	T	A	4: 155,853,666	D90E	probably damaging	Het
Fam135b	T	C	15: 71,464,030	I438M	probably benign	Het
Fam57a	A	G	11: 76,202,231	D33G	probably benign	Het
Fpr1	A	T	17: 17,876,635	M364K	probably benign	Het
Gm14139	C	G	2: 150,192,221	P185R	probably damaging	Het
Gm7030	T	C	17: 36,129,146	Y32C	probably damaging	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gpx7	C	A	4: 108,403,273	V109F	probably damaging	Het
Grhl2	T	C	15: 37,336,347		probably null	Het
Grn	A	G	11: 102,433,243	T53A	probably benign	Het
Hist1h1e	T	C	13: 23,621,846		probably benign	Het
Hmgxb3	T	C	18: 61,147,382	N683S	probably damaging	Het
Iigp1	T	C	18: 60,390,911	I367T	probably benign	Het
Itfg2	T	C	6: 128,411,669	E285G	probably damaging	Het
Itgav	T	A	2: 83,792,571	C662*	probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Lipe	T	C	7: 25,398,423	T32A	probably benign	Het
Lrrk2	A	G	15: 91,814,695	Y2475C	probably benign	Het
Mip	T	A	10: 128,226,006	L42*	probably null	Het
Mlc1	A	T	15: 88,965,996	D192E	probably benign	Het
Muc2	T	C	7: 141,745,488		probably benign	Het
Mybl1	T	C	1: 9,681,870	D260G	probably damaging	Het
Ncln	C	T	10: 81,487,685	V51I	probably benign	Het
Nlrp9a	T	C	7: 26,557,872	V305A	probably benign	Het
Nodal	G	A	10: 61,424,497	R309Q	possibly damaging	Het
Olfr1338	A	T	4: 118,754,224	F105I	probably damaging	Het
Olfr294	T	C	7: 86,615,676	Y323C	probably benign	Het
Olfr536	A	G	7: 140,503,919	I180T	probably damaging	Het
Olr1	T	C	6: 129,499,918	N128S	possibly damaging	Het
Orc1	T	A	4: 108,604,560	C585S	probably benign	Het
Pcmtd2	A	T	2: 181,855,129	I300F	probably damaging	Het
Pfkfb4	C	T	9: 109,025,042		probably benign	Het
Phactr3	T	A	2: 178,279,017	L180Q	possibly damaging	Het
Pigo	T	C	4: 43,021,083	T612A	probably benign	Het
Plch1	T	A	3: 63,709,531	D766V	probably damaging	Het
Plekhh3	T	C	11: 101,164,147		probably benign	Het
Ppp1r12b	T	A	1: 134,872,832	T547S	probably damaging	Het
Prkcb	T	A	7: 122,516,856	M186K	probably damaging	Het
Prpf3	A	T	3: 95,849,800		probably benign	Het
Psg23	T	C	7: 18,610,444	D362G	possibly damaging	Het
Reg3a	T	C	6: 78,381,131	L15P	probably damaging	Het
Scrib	A	T	15: 76,069,374	I5N	probably damaging	Het
Speg	C	T	1: 75,422,682	Q2005*	probably null	Het
Sppl3	A	T	5: 115,074,864	S51C	possibly damaging	Het
Sspo	A	G	6: 48,457,600	T1009A	probably damaging	Het
Syce1l	A	G	8: 113,654,947	Q164R	probably benign	Het
Sympk	T	C	7: 19,034,484	V126A	possibly damaging	Het
Tas2r110	T	A	6: 132,868,024	I6K	unknown	Het
Tas2r120	A	T	6: 132,657,768	H271L	probably damaging	Het
Tnn	T	A	1: 160,116,286	T986S	possibly damaging	Het
Trim5	T	C	7: 104,279,638	H32R	probably damaging	Het
Ttc13	A	G	8: 124,683,834	I360T	possibly damaging	Het
Uaca	A	G	9: 60,871,499	E1054G	probably damaging	Het
Usp16	T	A	16: 87,471,848		probably null	Het
Wee1	T	A	7: 110,130,836	S382R	probably damaging	Het
Wnt11	T	C	7: 98,846,564	S92P	probably damaging	Het
Zfp786	A	G	6: 47,820,226	C593R	probably damaging	Het
Zfp879	T	G	11: 50,833,162	I283L	possibly damaging	Het

Other mutations in Mcc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Mcc	APN	18	44449216	missense	possibly damaging	0.93
IGL00981:Mcc	APN	18	44449349	missense	probably damaging	0.99
IGL00985:Mcc	APN	18	44491239	missense	probably damaging	1.00
IGL01674:Mcc	APN	18	44491156	missense	probably benign	0.10
IGL01862:Mcc	APN	18	44759296	missense	probably benign	0.00
IGL01935:Mcc	APN	18	44519516	critical splice donor site	probably null
IGL02168:Mcc	APN	18	44449299	missense	probably damaging	0.97
IGL02449:Mcc	APN	18	44459958	missense	probably benign	0.10
IGL02613:Mcc	APN	18	44429954	missense	probably damaging	1.00
IGL02709:Mcc	APN	18	44445810	missense	possibly damaging	0.73
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0009:Mcc	UTSW	18	44445933	missense	probably damaging	1.00
R0021:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0022:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0062:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0063:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0064:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0217:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0218:Mcc	UTSW	18	44519516	critical splice donor site	probably benign
R0243:Mcc	UTSW	18	44759299	missense	probably benign
R0373:Mcc	UTSW	18	44475222	missense	probably benign	0.01
R0564:Mcc	UTSW	18	44468507	missense	probably damaging	1.00
R0604:Mcc	UTSW	18	44473756	missense	probably damaging	1.00
R0691:Mcc	UTSW	18	44445860	missense	possibly damaging	0.67
R0965:Mcc	UTSW	18	44724526	missense	probably benign	0.41
R1015:Mcc	UTSW	18	44724669	missense	probably benign
R1186:Mcc	UTSW	18	44759403	missense	probably benign
R1215:Mcc	UTSW	18	44468494	missense	possibly damaging	0.93
R1878:Mcc	UTSW	18	44468400	missense	possibly damaging	0.69
R1990:Mcc	UTSW	18	44491315	nonsense	probably null
R1991:Mcc	UTSW	18	44491315	nonsense	probably null
R1992:Mcc	UTSW	18	44491315	nonsense	probably null
R2186:Mcc	UTSW	18	44812078	missense	possibly damaging	0.71
R2189:Mcc	UTSW	18	44534230	missense	possibly damaging	0.93
R2258:Mcc	UTSW	18	44475136	missense	probably damaging	1.00
R2267:Mcc	UTSW	18	44519541	missense	probably damaging	0.99
R2310:Mcc	UTSW	18	44431366	missense	probably damaging	1.00
R2343:Mcc	UTSW	18	44459797	critical splice donor site	probably null
R2377:Mcc	UTSW	18	44519549	missense	probably damaging	1.00
R3110:Mcc	UTSW	18	44449263	missense	probably damaging	1.00
R4135:Mcc	UTSW	18	44724640	missense	probably benign	0.03
R4404:Mcc	UTSW	18	44759298	missense	probably benign
R4600:Mcc	UTSW	18	44519520	missense	probably damaging	1.00
R4606:Mcc	UTSW	18	44468421	missense	probably damaging	0.96
R4721:Mcc	UTSW	18	44519556	missense	probably damaging	1.00
R5858:Mcc	UTSW	18	44510141	missense	probably damaging	0.98
R5997:Mcc	UTSW	18	44449321	missense	probably damaging	1.00
R6482:Mcc	UTSW	18	44445864	missense	possibly damaging	0.94
R6502:Mcc	UTSW	18	44468390	nonsense	probably null
R6502:Mcc	UTSW	18	44468391	missense	probably damaging	1.00
R6518:Mcc	UTSW	18	44661811	start gained	probably benign
R6796:Mcc	UTSW	18	44724560	missense	probably benign
R6846:Mcc	UTSW	18	44473640	missense	possibly damaging	0.63
R6879:Mcc	UTSW	18	44812112	missense	unknown
R7147:Mcc	UTSW	18	44493513	missense	probably damaging	0.99
R7475:Mcc	UTSW	18	44476236	missense	probably damaging	0.98
R7515:Mcc	UTSW	18	44493432	missense	probably benign	0.02
R7608:Mcc	UTSW	18	44491227	missense	possibly damaging	0.83
R8092:Mcc	UTSW	18	44759232	missense	probably benign	0.00
R8119:Mcc	UTSW	18	44468433	missense	possibly damaging	0.95
R8162:Mcc	UTSW	18	44449441	critical splice acceptor site	probably null
R8187:Mcc	UTSW	18	44534260	missense	possibly damaging	0.53
R8716:Mcc	UTSW	18	44449336	missense	possibly damaging	0.92
R8744:Mcc	UTSW	18	44724572	missense	probably benign
R9383:Mcc	UTSW	18	44442918	missense	probably benign	0.24
R9517:Mcc	UTSW	18	44661727	missense	probably damaging	1.00
R9570:Mcc	UTSW	18	44445858	missense	probably damaging	0.97
R9590:Mcc	UTSW	18	44459910	missense	possibly damaging	0.93
X0010:Mcc	UTSW	18	44429957	missense	possibly damaging	0.94
Z1177:Mcc	UTSW	18	44491246	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGAGGCCATTGTCCAGAACG -3'
(R):5'- ACAGAGTCTAGTGGTGATAACTTGG -3'

Sequencing Primer
(F):5'- TTGTCCAGAACGAGGCAATTAC -3'
(R):5'- ACTTGGAAACATGGAGTCTCTC -3'

Posted On

2015-02-05