Incidental Mutation 'R3111:Pgm2'
ID263767
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R3111 ()
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99956025 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 11 (T11I)
Ref Sequence ENSEMBL: ENSMUSP00000099844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351] [ENSMUST00000102783]
Predicted Effect probably benign
Transcript: ENSMUST00000058351
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102783
AA Change: T11I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099844
Gene: ENSMUSG00000025791
AA Change: T11I

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 32 176 2.3e-37 PFAM
Pfam:PGM_PMM_II 211 319 1.2e-19 PFAM
Pfam:PGM_PMM_III 324 438 3.7e-33 PFAM
Pfam:PGM_PMM_IV 455 561 3.6e-8 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,178,829 K1554* probably null Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Disp1 A T 1: 183,087,523 M1111K probably damaging Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gad1-ps A G 10: 99,444,521 noncoding transcript Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Mfap3 T C 11: 57,529,580 V129A probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Myh4 T A 11: 67,246,450 L499Q possibly damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nmnat3 T A 9: 98,399,480 I45N probably damaging Het
Olfr392 T C 11: 73,814,186 R299G probably benign Het
Osbpl9 T C 4: 109,083,093 I232V probably benign Het
Pcdha12 A T 18: 37,022,190 H654L probably damaging Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pds5b T C 5: 150,719,907 S65P probably damaging Het
Phf24 G A 4: 42,938,316 V226I probably benign Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ptprf T C 4: 118,211,432 D1713G probably damaging Het
Rbp3 G T 14: 33,954,112 V6F probably benign Het
Sac3d1 T C 19: 6,118,357 K77R probably benign Het
Slc1a6 T A 10: 78,789,081 S107T probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Tgfbi T C 13: 56,609,734 Y30H probably damaging Het
Tmem217 A T 17: 29,526,558 V66D probably damaging Het
Tnn C A 1: 160,107,055 D1263Y probably damaging Het
Ylpm1 T C 12: 85,029,371 F499L probably damaging Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962070 missense possibly damaging 0.70
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6311:Pgm2 UTSW 4 99970040 missense possibly damaging 0.93
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6818:Pgm2 UTSW 4 99963566 missense probably damaging 1.00
R6892:Pgm2 UTSW 4 99929708 missense probably benign
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8724:Pgm2 UTSW 4 99929767 missense probably benign 0.00
R8893:Pgm2 UTSW 4 99967100 missense probably damaging 0.99
RF018:Pgm2 UTSW 4 99962303 splice site probably null
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGGAGACAATCACCATAGGG -3'
(R):5'- GATCCCTGGCGATCTTTGAG -3'

Sequencing Primer
(F):5'- TGAGACTTCCTAACCGACAGTGATG -3'
(R):5'- CGATCTTTGAGGTCTATGGAAAAG -3'
Posted On2015-02-05