Incidental Mutation 'R3111:Mip'
ID |
263784 |
Institutional Source |
Beutler Lab
|
Gene Symbol |
Mip
|
Ensembl Gene |
ENSMUSG00000025389 |
Gene Name |
major intrinsic protein of lens fiber |
Synonyms |
Svl, Aqp0, shrivelled, Cts, lens opacity, aquaporin 0, Lop, MIP26 |
Accession Numbers |
|
Essential gene? |
Probably non essential
(E-score: 0.132)
|
Stock # |
R3111 ()
|
Quality Score |
225 |
Status
|
Not validated
|
Chromosome |
10 |
Chromosomal Location |
128061707-128067681 bp(+) (GRCm39) |
Type of Mutation |
nonsense |
DNA Base Change (assembly) |
T to A
at 128061875 bp (GRCm39)
|
Zygosity |
Heterozygous |
Amino Acid Change |
Leucine to Stop codon
at position 42
(L42*)
|
Ref Sequence |
ENSEMBL: ENSMUSP00000026455
(fasta)
|
Gene Model |
predicted gene model for transcript(s):
[ENSMUST00000026455]
|
AlphaFold |
P51180 |
Predicted Effect |
probably null
Transcript: ENSMUST00000026455
AA Change: L42*
|
SMART Domains |
Protein: ENSMUSP00000026455 Gene: ENSMUSG00000025389 AA Change: L42*
Domain | Start | End | E-Value | Type |
Pfam:MIP
|
3 |
219 |
5.6e-82 |
PFAM |
|
Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000180407
|
Meta Mutation Damage Score |
0.9755 |
Coding Region Coverage |
- 1x: 98.8%
- 3x: 98.4%
- 10x: 97.3%
- 20x: 95.2%
|
Validation Efficiency |
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major intrinsic protein is a member of the water-transporting aquaporins as well as the original member of the MIP family of channel proteins. The function of the fiber cell membrane protein encoded by this gene is undetermined, yet this protein is speculated to play a role in intracellular communication. The MIP protein is expressed in the ocular lens and is required for correct lens function. This gene has been mapped among aquaporins AQP2, AQP5, and AQP6, in a potential gene cluster at 12q13. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygotes have microphthalmia and lens opacity. Other defects may include degeneration of lens fiber cells, vacuolization of lens fibers and reduced gamma:alpha crystallin ratio. Heterozygotes have less severe forms of lens cataract and microphthalmia. [provided by MGI curators]
|
Allele List at MGI |
|
Other mutations in this stock |
Total: 31 list
Gene | Ref | Var | Chr/Loc | Mutation | Predicted Effect | Zygosity |
Abca6 |
T |
A |
11: 110,069,655 (GRCm39) |
K1554* |
probably null |
Het |
Car12 |
C |
T |
9: 66,661,008 (GRCm39) |
T124I |
probably damaging |
Het |
Ccdc180 |
T |
A |
4: 45,900,470 (GRCm39) |
I278K |
possibly damaging |
Het |
Disp1 |
A |
T |
1: 182,869,087 (GRCm39) |
M1111K |
probably damaging |
Het |
Fpr1 |
A |
T |
17: 18,096,897 (GRCm39) |
M364K |
probably benign |
Het |
Gad1-ps |
A |
G |
10: 99,280,383 (GRCm39) |
|
noncoding transcript |
Het |
Grn |
A |
G |
11: 102,324,069 (GRCm39) |
T53A |
probably benign |
Het |
Hmgxb3 |
T |
C |
18: 61,280,454 (GRCm39) |
N683S |
probably damaging |
Het |
Jarid2 |
T |
A |
13: 45,059,752 (GRCm39) |
N661K |
probably damaging |
Het |
Mfap3 |
T |
C |
11: 57,420,406 (GRCm39) |
V129A |
probably damaging |
Het |
Myh4 |
T |
A |
11: 67,137,276 (GRCm39) |
L499Q |
possibly damaging |
Het |
Ncln |
C |
T |
10: 81,323,519 (GRCm39) |
V51I |
probably benign |
Het |
Nmnat3 |
T |
A |
9: 98,281,533 (GRCm39) |
I45N |
probably damaging |
Het |
Or1e32 |
T |
C |
11: 73,705,012 (GRCm39) |
R299G |
probably benign |
Het |
Osbpl9 |
T |
C |
4: 108,940,290 (GRCm39) |
I232V |
probably benign |
Het |
Pcdha12 |
A |
T |
18: 37,155,243 (GRCm39) |
H654L |
probably damaging |
Het |
Pcmtd2 |
A |
T |
2: 181,496,922 (GRCm39) |
I300F |
probably damaging |
Het |
Pds5b |
T |
C |
5: 150,643,372 (GRCm39) |
S65P |
probably damaging |
Het |
Pgm1 |
C |
T |
4: 99,813,222 (GRCm39) |
T11I |
probably benign |
Het |
Phf24 |
G |
A |
4: 42,938,316 (GRCm39) |
V226I |
probably benign |
Het |
Pigo |
T |
C |
4: 43,021,083 (GRCm39) |
T612A |
probably benign |
Het |
Plekhh3 |
T |
C |
11: 101,054,973 (GRCm39) |
|
probably benign |
Het |
Ptprf |
T |
C |
4: 118,068,629 (GRCm39) |
D1713G |
probably damaging |
Het |
Rbp3 |
G |
T |
14: 33,676,069 (GRCm39) |
V6F |
probably benign |
Het |
Sac3d1 |
T |
C |
19: 6,168,387 (GRCm39) |
K77R |
probably benign |
Het |
Slc1a6 |
T |
A |
10: 78,624,915 (GRCm39) |
S107T |
probably damaging |
Het |
Syce1l |
A |
G |
8: 114,381,579 (GRCm39) |
Q164R |
probably benign |
Het |
Tgfbi |
T |
C |
13: 56,757,547 (GRCm39) |
Y30H |
probably damaging |
Het |
Tmem217 |
A |
T |
17: 29,745,532 (GRCm39) |
V66D |
probably damaging |
Het |
Tnn |
C |
A |
1: 159,934,625 (GRCm39) |
D1263Y |
probably damaging |
Het |
Ylpm1 |
T |
C |
12: 85,076,145 (GRCm39) |
F499L |
probably damaging |
Het |
|
Other mutations in Mip |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
R0963:Mip
|
UTSW |
10 |
128,061,854 (GRCm39) |
missense |
probably benign |
0.00 |
R1952:Mip
|
UTSW |
10 |
128,061,772 (GRCm39) |
missense |
possibly damaging |
0.91 |
R3110:Mip
|
UTSW |
10 |
128,061,875 (GRCm39) |
nonsense |
probably null |
|
R3112:Mip
|
UTSW |
10 |
128,061,875 (GRCm39) |
nonsense |
probably null |
|
R4646:Mip
|
UTSW |
10 |
128,062,922 (GRCm39) |
missense |
probably benign |
0.00 |
R4648:Mip
|
UTSW |
10 |
128,062,922 (GRCm39) |
missense |
probably benign |
0.00 |
R5650:Mip
|
UTSW |
10 |
128,061,934 (GRCm39) |
missense |
possibly damaging |
0.74 |
R6227:Mip
|
UTSW |
10 |
128,061,875 (GRCm39) |
nonsense |
probably null |
|
R8124:Mip
|
UTSW |
10 |
128,062,070 (GRCm39) |
missense |
possibly damaging |
0.92 |
R9367:Mip
|
UTSW |
10 |
128,063,029 (GRCm39) |
missense |
probably damaging |
1.00 |
|
Predicted Primers |
PCR Primer
(F):5'- CTCTATAAAGGGGACTGTCAACCC -3'
(R):5'- TAGGTTTCCTCGGACAGCTG -3'
Sequencing Primer
(F):5'- ACTGTCAACCCAGGCAGGTC -3'
(R):5'- TGGGGTGACACTGTACAGCAC -3'
|
Posted On |
2015-02-05 |