Incidental Mutation 'R3111:Mip'
ID263784
Institutional Source Beutler Lab
Gene Symbol Mip
Ensembl Gene ENSMUSG00000025389
Gene Namemajor intrinsic protein of lens fiber
SynonymsAqp0, MIP26, aquaporin 0, shrivelled, lens opacity, Cts, Svl, Lop
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R3111 ()
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128225838-128231812 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128226006 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 42 (L42*)
Ref Sequence ENSEMBL: ENSMUSP00000026455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026455]
Predicted Effect probably null
Transcript: ENSMUST00000026455
AA Change: L42*
SMART Domains Protein: ENSMUSP00000026455
Gene: ENSMUSG00000025389
AA Change: L42*

DomainStartEndE-ValueType
Pfam:MIP 3 219 5.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180407
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major intrinsic protein is a member of the water-transporting aquaporins as well as the original member of the MIP family of channel proteins. The function of the fiber cell membrane protein encoded by this gene is undetermined, yet this protein is speculated to play a role in intracellular communication. The MIP protein is expressed in the ocular lens and is required for correct lens function. This gene has been mapped among aquaporins AQP2, AQP5, and AQP6, in a potential gene cluster at 12q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have microphthalmia and lens opacity. Other defects may include degeneration of lens fiber cells, vacuolization of lens fibers and reduced gamma:alpha crystallin ratio. Heterozygotes have less severe forms of lens cataract and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,178,829 K1554* probably null Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Disp1 A T 1: 183,087,523 M1111K probably damaging Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gad1-ps A G 10: 99,444,521 noncoding transcript Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Mfap3 T C 11: 57,529,580 V129A probably damaging Het
Myh4 T A 11: 67,246,450 L499Q possibly damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nmnat3 T A 9: 98,399,480 I45N probably damaging Het
Olfr392 T C 11: 73,814,186 R299G probably benign Het
Osbpl9 T C 4: 109,083,093 I232V probably benign Het
Pcdha12 A T 18: 37,022,190 H654L probably damaging Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pds5b T C 5: 150,719,907 S65P probably damaging Het
Pgm2 C T 4: 99,956,025 T11I probably benign Het
Phf24 G A 4: 42,938,316 V226I probably benign Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ptprf T C 4: 118,211,432 D1713G probably damaging Het
Rbp3 G T 14: 33,954,112 V6F probably benign Het
Sac3d1 T C 19: 6,118,357 K77R probably benign Het
Slc1a6 T A 10: 78,789,081 S107T probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Tgfbi T C 13: 56,609,734 Y30H probably damaging Het
Tmem217 A T 17: 29,526,558 V66D probably damaging Het
Tnn C A 1: 160,107,055 D1263Y probably damaging Het
Ylpm1 T C 12: 85,029,371 F499L probably damaging Het
Other mutations in Mip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0963:Mip UTSW 10 128225985 missense probably benign 0.00
R1952:Mip UTSW 10 128225903 missense possibly damaging 0.91
R3110:Mip UTSW 10 128226006 nonsense probably null
R3112:Mip UTSW 10 128226006 nonsense probably null
R4646:Mip UTSW 10 128227053 missense probably benign 0.00
R4648:Mip UTSW 10 128227053 missense probably benign 0.00
R5650:Mip UTSW 10 128226065 missense possibly damaging 0.74
R6227:Mip UTSW 10 128226006 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTATAAAGGGGACTGTCAACCC -3'
(R):5'- TAGGTTTCCTCGGACAGCTG -3'

Sequencing Primer
(F):5'- ACTGTCAACCCAGGCAGGTC -3'
(R):5'- TGGGGTGACACTGTACAGCAC -3'
Posted On2015-02-05