Mutagenetix > Incidental Mutations

Incidental Mutation 'R3110:Orc1'

263812

Institutional Source

Beutler Lab

Gene Symbol

Orc1

Ensembl Gene

ENSMUSG00000028587

Gene Name

origin recognition complex, subunit 1

Synonyms

MmORC1, Orc1l

MMRRC Submission

040584-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108579423-108614833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108604560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 585 (C585S)

Ref Sequence

ENSEMBL: ENSMUSP00000099805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102744]

AlphaFold

Q9Z1N2

PDB Structure

Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000102744
AA Change: C585S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: C585S

Domain	Start	End	E-Value	Type
BAH	44	170	1.88e-31	SMART
low complexity region	394	417	N/A	INTRINSIC
AAA	505	656	1e-7	SMART
Cdc6_C	757	837	5.45e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129931

Meta Mutation Damage Score

0.1044

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	G	2: 111,228,054	L131F	probably damaging	Het
Abca6	T	A	11: 110,178,829	K1554*	probably null	Het
Acads	T	C	5: 115,117,698	H26R	probably benign	Het
Acer1	G	A	17: 56,958,406	T141I	probably damaging	Het
Adam15	C	G	3: 89,347,457	V99L	probably benign	Het
Ankrd13b	A	G	11: 77,477,505	V97A	possibly damaging	Het
Anpep	T	C	7: 79,841,972	T94A	probably benign	Het
Atp1a3	T	C	7: 24,994,694	N345S	probably damaging	Het
Btn1a1	T	A	13: 23,461,551	N216I	possibly damaging	Het
Cacna1s	G	A	1: 136,075,093	W62*	probably null	Het
Ccdc141	C	T	2: 77,039,486	V892I	probably benign	Het
Ccdc180	T	A	4: 45,900,470	I278K	possibly damaging	Het
Cdc7	T	G	5: 106,974,698		probably null	Het
Cpb1	C	T	3: 20,265,357	V188M	probably damaging	Het
Dock5	A	G	14: 67,857,922	I101T	possibly damaging	Het
Dqx1	T	C	6: 83,058,972	V95A	probably damaging	Het
Dvl1	T	A	4: 155,853,666	D90E	probably damaging	Het
Ebf1	T	A	11: 44,643,398		probably benign	Het
Fam135b	T	C	15: 71,464,030	I438M	probably benign	Het
Fam57a	A	G	11: 76,202,231	D33G	probably benign	Het
Fpr1	A	T	17: 17,876,635	M364K	probably benign	Het
Gm14139	C	G	2: 150,192,221	P185R	probably damaging	Het
Gm7030	T	C	17: 36,129,146	Y32C	probably damaging	Het
Gm9932	A	T	5: 100,198,935		unknown	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gpx7	C	A	4: 108,403,273	V109F	probably damaging	Het
Grhl2	T	C	15: 37,336,347		probably null	Het
Grn	A	G	11: 102,433,243	T53A	probably benign	Het
Hist1h1e	T	C	13: 23,621,846		probably benign	Het
Hmgxb3	T	C	18: 61,147,382	N683S	probably damaging	Het
Iigp1	T	C	18: 60,390,911	I367T	probably benign	Het
Itfg2	T	C	6: 128,411,669	E285G	probably damaging	Het
Itgav	T	A	2: 83,792,571	C662*	probably null	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Jmjd1c	T	A	10: 67,240,084		probably benign	Het
Lipe	T	C	7: 25,398,423	T32A	probably benign	Het
Lrrk2	A	G	15: 91,814,695	Y2475C	probably benign	Het
Mcc	T	C	18: 44,449,263	D607G	probably damaging	Het
Mip	T	A	10: 128,226,006	L42*	probably null	Het
Mlc1	A	T	15: 88,965,996	D192E	probably benign	Het
Muc2	T	C	7: 141,745,488		probably benign	Het
Mybl1	T	C	1: 9,681,870	D260G	probably damaging	Het
Ncln	C	T	10: 81,487,685	V51I	probably benign	Het
Nlrp9a	T	C	7: 26,557,872	V305A	probably benign	Het
Nodal	G	A	10: 61,424,497	R309Q	possibly damaging	Het
Olfr1338	A	T	4: 118,754,224	F105I	probably damaging	Het
Olfr294	T	C	7: 86,615,676	Y323C	probably benign	Het
Olfr536	A	G	7: 140,503,919	I180T	probably damaging	Het
Olr1	T	C	6: 129,499,918	N128S	possibly damaging	Het
Pcmtd2	A	T	2: 181,855,129	I300F	probably damaging	Het
Phactr3	T	A	2: 178,279,017	L180Q	possibly damaging	Het
Pigo	T	C	4: 43,021,083	T612A	probably benign	Het
Plch1	T	A	3: 63,709,531	D766V	probably damaging	Het
Plekhh3	T	C	11: 101,164,147		probably benign	Het
Ppp1r12b	T	A	1: 134,872,832	T547S	probably damaging	Het
Prkcb	T	A	7: 122,516,856	M186K	probably damaging	Het
Prpf3	A	T	3: 95,849,800		probably benign	Het
Psg23	T	C	7: 18,610,444	D362G	possibly damaging	Het
Reg3a	T	C	6: 78,381,131	L15P	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Scrib	A	T	15: 76,069,374	I5N	probably damaging	Het
Speg	C	T	1: 75,422,682	Q2005*	probably null	Het
Sppl3	A	T	5: 115,074,864	S51C	possibly damaging	Het
Sspo	A	G	6: 48,457,600	T1009A	probably damaging	Het
Syce1l	A	G	8: 113,654,947	Q164R	probably benign	Het
Sympk	T	C	7: 19,034,484	V126A	possibly damaging	Het
Tas2r110	T	A	6: 132,868,024	I6K	unknown	Het
Tas2r120	A	T	6: 132,657,768	H271L	probably damaging	Het
Tnn	T	A	1: 160,116,286	T986S	possibly damaging	Het
Trim5	T	C	7: 104,279,638	H32R	probably damaging	Het
Ttc13	A	G	8: 124,683,834	I360T	possibly damaging	Het
Uaca	A	G	9: 60,871,499	E1054G	probably damaging	Het
Usp16	T	A	16: 87,471,848		probably null	Het
Wee1	T	A	7: 110,130,836	S382R	probably damaging	Het
Wnt11	T	C	7: 98,846,564	S92P	probably damaging	Het
Zfp786	A	G	6: 47,820,226	C593R	probably damaging	Het
Zfp879	T	G	11: 50,833,162	I283L	possibly damaging	Het

Other mutations in Orc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Orc1	APN	4	108595325	splice site	probably benign
IGL00709:Orc1	APN	4	108590778	critical splice donor site	probably null
IGL01124:Orc1	APN	4	108588787	splice site	probably benign
IGL01514:Orc1	APN	4	108602052	missense	probably damaging	0.97
IGL01677:Orc1	APN	4	108604585	missense	probably damaging	1.00
IGL01782:Orc1	APN	4	108606268	missense	possibly damaging	0.78
IGL01886:Orc1	APN	4	108603957	splice site	probably null
IGL01912:Orc1	APN	4	108590744	missense	probably damaging	1.00
IGL02057:Orc1	APN	4	108588729	missense	possibly damaging	0.53
IGL02155:Orc1	APN	4	108590677	missense	probably benign	0.00
IGL02311:Orc1	APN	4	108599974	missense	probably benign
IGL02616:Orc1	APN	4	108595479	missense	probably benign	0.00
R0012:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0195:Orc1	UTSW	4	108614308	nonsense	probably null
R0239:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0239:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0611:Orc1	UTSW	4	108602032	missense	probably benign
R1351:Orc1	UTSW	4	108595367	missense	probably benign	0.01
R1966:Orc1	UTSW	4	108612217	missense	probably damaging	1.00
R2018:Orc1	UTSW	4	108590700	missense	possibly damaging	0.95
R2398:Orc1	UTSW	4	108601969	missense	possibly damaging	0.68
R3112:Orc1	UTSW	4	108604560	missense	probably benign	0.01
R3712:Orc1	UTSW	4	108604021	missense	probably damaging	1.00
R3716:Orc1	UTSW	4	108614459	missense	probably damaging	1.00
R3829:Orc1	UTSW	4	108605631	missense	probably damaging	1.00
R4282:Orc1	UTSW	4	108606274	missense	probably benign	0.18
R4320:Orc1	UTSW	4	108588776	missense	probably benign
R4321:Orc1	UTSW	4	108588776	missense	probably benign
R4322:Orc1	UTSW	4	108588776	missense	probably benign
R4348:Orc1	UTSW	4	108593452	missense	probably damaging	0.98
R4562:Orc1	UTSW	4	108602055	critical splice donor site	probably null
R4772:Orc1	UTSW	4	108579568	utr 5 prime	probably benign
R4914:Orc1	UTSW	4	108604558	missense	probably damaging	1.00
R4964:Orc1	UTSW	4	108614473	makesense	probably null
R5219:Orc1	UTSW	4	108590769	missense	probably damaging	1.00
R5428:Orc1	UTSW	4	108599940	missense	probably benign	0.00
R5655:Orc1	UTSW	4	108593439	missense	probably benign	0.09
R5693:Orc1	UTSW	4	108613079	missense	probably benign	0.01
R5936:Orc1	UTSW	4	108601983	missense	probably benign	0.10
R5960:Orc1	UTSW	4	108606298	missense	possibly damaging	0.67
R6294:Orc1	UTSW	4	108590670	missense	probably benign	0.01
R6504:Orc1	UTSW	4	108590717	missense	probably benign	0.15
R6533:Orc1	UTSW	4	108597447	missense	probably benign	0.05
R6775:Orc1	UTSW	4	108603455	missense	probably damaging	1.00
R7123:Orc1	UTSW	4	108588687	start codon destroyed	probably damaging	0.99
R7156:Orc1	UTSW	4	108595459	missense	probably benign	0.00
R7327:Orc1	UTSW	4	108588714	missense	probably benign	0.01
R7552:Orc1	UTSW	4	108588754	missense	probably benign	0.41
R7842:Orc1	UTSW	4	108605547	missense	probably benign	0.00
R7899:Orc1	UTSW	4	108603371	splice site	probably null
R8033:Orc1	UTSW	4	108605564	missense	probably damaging	1.00
R9442:Orc1	UTSW	4	108612160	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TAATATCCCGCTAGGTAAAGGGA -3'
(R):5'- CTCTTGTACTCCTGGGGCA -3'

Sequencing Primer
(F):5'- TATCCCGCTAGGTAAAGGGACTAGAG -3'
(R):5'- AATGCCTGGTTCACCCTGAGTAAG -3'

Posted On

2015-02-05