Incidental Mutation 'R3110:Olfr1338'
ID263813
Institutional Source Beutler Lab
Gene Symbol Olfr1338
Ensembl Gene ENSMUSG00000095218
Gene Nameolfactory receptor 1338
SynonymsMOR259-9, GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-4P, Olfr1524-ps1
MMRRC Submission 040584-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R3110 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118751975-118758737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118754224 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 105 (F105I)
Ref Sequence ENSEMBL: ENSMUSP00000092427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084315] [ENSMUST00000214922] [ENSMUST00000216559]
Predicted Effect probably damaging
Transcript: ENSMUST00000084315
AA Change: F105I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092427
Gene: ENSMUSG00000095218
AA Change: F105I

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1e-8 PFAM
Pfam:7tm_1 42 291 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214922
AA Change: F107I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216559
AA Change: F107I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Ebf1 T A 11: 44,643,398 probably benign Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gm9932 A T 5: 100,198,935 unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Jmjd1c T A 10: 67,240,084 probably benign Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Olfr1338
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr1338 APN 4 118753762 missense possibly damaging 0.78
IGL02726:Olfr1338 APN 4 118753764 missense probably benign 0.00
IGL02928:Olfr1338 APN 4 118754500 missense probably damaging 1.00
IGL03102:Olfr1338 APN 4 118753934 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0299:Olfr1338 UTSW 4 118754535 start codon destroyed probably null 0.82
R0501:Olfr1338 UTSW 4 118753830 missense probably benign 0.00
R1301:Olfr1338 UTSW 4 118753619 missense probably benign
R1719:Olfr1338 UTSW 4 118753600 missense possibly damaging 0.78
R2327:Olfr1338 UTSW 4 118754134 missense probably benign 0.13
R3112:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R4582:Olfr1338 UTSW 4 118753893 missense probably damaging 1.00
R4615:Olfr1338 UTSW 4 118754137 missense probably benign 0.34
R5640:Olfr1338 UTSW 4 118753789 missense probably benign 0.07
R6513:Olfr1338 UTSW 4 118754027 nonsense probably null
R6889:Olfr1338 UTSW 4 118754307 missense probably damaging 0.99
R7157:Olfr1338 UTSW 4 118754418 missense possibly damaging 0.93
R7168:Olfr1338 UTSW 4 118753851 missense probably damaging 0.98
R7378:Olfr1338 UTSW 4 118754175 missense possibly damaging 0.74
R7451:Olfr1338 UTSW 4 118753687 missense probably benign 0.03
R7770:Olfr1338 UTSW 4 118754057 missense probably benign 0.04
R7847:Olfr1338 UTSW 4 118754368 missense possibly damaging 0.79
R7930:Olfr1338 UTSW 4 118754368 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGAAATAGTGGTCAACCCTTTTGG -3'
(R):5'- TCATCATGCTGGTCTGCCTG -3'

Sequencing Primer
(F):5'- CCACAATATGGCAGACTCATGGTG -3'
(R):5'- TGGTCTGCCTGGACACACAG -3'
Posted On2015-02-05