Incidental Mutation 'R3110:Zfp786'
ID263820
Institutional Source Beutler Lab
Gene Symbol Zfp786
Ensembl Gene ENSMUSG00000051499
Gene Namezinc finger protein 786
SynonymsA730012O14Rik
MMRRC Submission 040584-MU
Accession Numbers

Genbank: NM_177882; MGI: 3026883

Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3110 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47819266-47830867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47820226 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 593 (C593R)
Ref Sequence ENSEMBL: ENSMUSP00000057495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058844]
Predicted Effect probably damaging
Transcript: ENSMUST00000058844
AA Change: C593R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057495
Gene: ENSMUSG00000051499
AA Change: C593R

DomainStartEndE-ValueType
KRAB 9 69 2.6e-22 SMART
low complexity region 156 164 N/A INTRINSIC
ZnF_C2H2 240 262 5.34e-1 SMART
ZnF_C2H2 268 295 1.41e2 SMART
ZnF_C2H2 420 440 1.21e2 SMART
ZnF_C2H2 448 470 3.52e-1 SMART
ZnF_C2H2 476 498 1.89e-1 SMART
ZnF_C2H2 504 526 1.69e-3 SMART
ZnF_C2H2 532 554 5.59e-4 SMART
ZnF_C2H2 560 582 4.79e-3 SMART
ZnF_C2H2 588 610 3.69e-4 SMART
ZnF_C2H2 616 638 3.63e-3 SMART
ZnF_C2H2 644 665 5.92e0 SMART
ZnF_C2H2 671 693 2.57e-3 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143979
Meta Mutation Damage Score 0.9200 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Ebf1 T A 11: 44,643,398 probably benign Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gm9932 A T 5: 100,198,935 unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Jmjd1c T A 10: 67,240,084 probably benign Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Zfp786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp786 APN 6 47819671 makesense probably null
IGL02442:Zfp786 APN 6 47821367 missense probably benign 0.00
IGL02674:Zfp786 APN 6 47820493 missense probably benign 0.22
IGL02814:Zfp786 APN 6 47819841 missense probably damaging 1.00
IGL03072:Zfp786 APN 6 47821243 missense probably benign 0.01
IGL03294:Zfp786 APN 6 47821324 nonsense probably null
IGL03393:Zfp786 APN 6 47821524 missense possibly damaging 0.88
3-1:Zfp786 UTSW 6 47820445 missense probably damaging 1.00
PIT4581001:Zfp786 UTSW 6 47819822 missense probably damaging 1.00
R1071:Zfp786 UTSW 6 47821305 missense possibly damaging 0.91
R1426:Zfp786 UTSW 6 47825079 missense probably benign 0.17
R1976:Zfp786 UTSW 6 47819757 missense probably damaging 1.00
R2114:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2115:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2117:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2176:Zfp786 UTSW 6 47820971 missense possibly damaging 0.65
R2304:Zfp786 UTSW 6 47820699 missense probably damaging 1.00
R3112:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3623:Zfp786 UTSW 6 47821423 missense probably benign 0.00
R4654:Zfp786 UTSW 6 47820934 missense probably benign 0.01
R4741:Zfp786 UTSW 6 47820691 missense probably damaging 1.00
R4927:Zfp786 UTSW 6 47820153 missense probably benign 0.43
R4936:Zfp786 UTSW 6 47821268 nonsense probably null
R5084:Zfp786 UTSW 6 47820019 missense probably benign 0.00
R5445:Zfp786 UTSW 6 47819685 missense probably damaging 1.00
R6662:Zfp786 UTSW 6 47826986 missense probably damaging 1.00
R7290:Zfp786 UTSW 6 47819995 missense probably damaging 1.00
R7561:Zfp786 UTSW 6 47819733 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCACACTGGCAAGAGAACG -3'
(R):5'- CTTCACCCATCAGTGCAAGCTC -3'

Sequencing Primer
(F):5'- CTGGCAAGAGAACGGCATCTG -3'
(R):5'- ATCAGTGCAAGCTCCGTGAG -3'
Posted On2015-02-05