Incidental Mutation 'R3110:Ttc13'
ID263831
Institutional Source Beutler Lab
Gene Symbol Ttc13
Ensembl Gene ENSMUSG00000037300
Gene Nametetratricopeptide repeat domain 13
SynonymsMGC:28881
MMRRC Submission 040584-MU
Accession Numbers

Genbank: NM_145607; MGI: 28881

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3110 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location124671332-124721983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124683834 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 360 (I360T)
Ref Sequence ENSEMBL: ENSMUSP00000156040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041614] [ENSMUST00000117624] [ENSMUST00000118134] [ENSMUST00000214828] [ENSMUST00000231984]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041614
AA Change: I360T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038484
Gene: ENSMUSG00000037300
AA Change: I360T

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:TPR_11 153 204 3e-8 PFAM
Pfam:TPR_19 154 213 5.1e-8 PFAM
Pfam:TPR_1 173 206 6.1e-10 PFAM
Pfam:TPR_2 173 206 1.2e-7 PFAM
Pfam:TPR_8 173 206 5.2e-8 PFAM
Pfam:TPR_16 177 241 6.5e-11 PFAM
Pfam:TPR_9 179 249 3.5e-6 PFAM
Pfam:TPR_11 204 272 2.2e-8 PFAM
Pfam:TPR_1 207 240 3.3e-5 PFAM
Pfam:TPR_2 207 240 1.9e-5 PFAM
Blast:UTG 692 755 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117624
AA Change: I382T

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114043
Gene: ENSMUSG00000037300
AA Change: I382T

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 161 2e-13 BLAST
TPR 162 194 1.08e1 SMART
TPR 195 228 2.24e-7 SMART
TPR 229 262 3.67e-3 SMART
Blast:UTG 714 777 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000118134
AA Change: I436T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113383
Gene: ENSMUSG00000037300
AA Change: I436T

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Blast:TPR 128 156 4e-10 BLAST
TPR 181 214 5.56e-3 SMART
TPR 215 248 1.17e-1 SMART
TPR 249 282 2.24e-7 SMART
TPR 283 316 3.67e-3 SMART
Blast:UTG 768 831 1e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140350
Predicted Effect possibly damaging
Transcript: ENSMUST00000214828
AA Change: I489T

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231984
AA Change: I360T

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.3181 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Ebf1 T A 11: 44,643,398 probably benign Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gm9932 A T 5: 100,198,935 unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Jmjd1c T A 10: 67,240,084 probably benign Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Ttc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc13 APN 8 124688847 splice site probably benign
IGL01086:Ttc13 APN 8 124675346 missense probably damaging 0.98
IGL01411:Ttc13 APN 8 124683285 missense probably damaging 1.00
IGL01511:Ttc13 APN 8 124676371 missense probably damaging 1.00
IGL01610:Ttc13 APN 8 124676344 missense probably damaging 1.00
IGL01626:Ttc13 APN 8 124673738 splice site probably benign
IGL01967:Ttc13 APN 8 124712647 missense probably damaging 0.99
IGL01995:Ttc13 APN 8 124688882 missense probably damaging 1.00
IGL02456:Ttc13 APN 8 124690361 critical splice acceptor site probably null
IGL02816:Ttc13 APN 8 124712676 missense possibly damaging 0.89
3-1:Ttc13 UTSW 8 124679009 missense possibly damaging 0.81
LCD18:Ttc13 UTSW 8 124675866 intron probably benign
R0126:Ttc13 UTSW 8 124683291 missense probably damaging 0.99
R0391:Ttc13 UTSW 8 124674401 missense probably damaging 1.00
R0602:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0629:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0638:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R0714:Ttc13 UTSW 8 124674366 missense probably damaging 0.99
R1981:Ttc13 UTSW 8 124714187 critical splice donor site probably null
R2051:Ttc13 UTSW 8 124672211 splice site probably null
R2324:Ttc13 UTSW 8 124679057 missense probably damaging 1.00
R2404:Ttc13 UTSW 8 124678997 splice site probably benign
R2571:Ttc13 UTSW 8 124683799 missense probably damaging 1.00
R3112:Ttc13 UTSW 8 124683834 missense possibly damaging 0.90
R4560:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4562:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4563:Ttc13 UTSW 8 124675277 missense probably damaging 1.00
R4565:Ttc13 UTSW 8 124682087 missense probably damaging 1.00
R4855:Ttc13 UTSW 8 124674435 missense probably damaging 1.00
R4998:Ttc13 UTSW 8 124680056 missense probably damaging 1.00
R5137:Ttc13 UTSW 8 124694935 nonsense probably null
R5397:Ttc13 UTSW 8 124675263 missense possibly damaging 0.94
R5619:Ttc13 UTSW 8 124679944 intron probably benign
R5966:Ttc13 UTSW 8 124682220 intron probably benign
R6092:Ttc13 UTSW 8 124679033 missense probably benign 0.36
R6321:Ttc13 UTSW 8 124683191 missense probably damaging 1.00
R6439:Ttc13 UTSW 8 124673482 missense probably benign 0.02
R6737:Ttc13 UTSW 8 124682161 critical splice acceptor site probably null
R6804:Ttc13 UTSW 8 124699687 missense probably damaging 1.00
R6967:Ttc13 UTSW 8 124688618 missense probably benign 0.17
R7542:Ttc13 UTSW 8 124675103 intron probably null
X0027:Ttc13 UTSW 8 124673589 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGAGTGCAGTAAACAAC -3'
(R):5'- CATGTGGTAGCAAACAGGCC -3'

Sequencing Primer
(F):5'- GGCTGAGTGCAGTAAACAACAATTTC -3'
(R):5'- CCACATGACTTGCAAAGAGTGGTTG -3'
Posted On2015-02-05