Incidental Mutation 'R3110:Jarid2'
ID 263844
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Name jumonji, AT rich interactive domain 2
Synonyms jumonji, Jmj
MMRRC Submission 040584-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3110 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 44729474-44921643 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44906276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 661 (N661K)
Ref Sequence ENSEMBL: ENSMUSP00000134675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]
AlphaFold Q62315
Predicted Effect probably damaging
Transcript: ENSMUST00000044608
AA Change: N661K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: N661K

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173246
AA Change: N661K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: N661K

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173367
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000173704
AA Change: N661K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: N661K

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173906
AA Change: N623K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: N623K

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174683
Meta Mutation Damage Score 0.3303 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Ebf1 T A 11: 44,643,398 probably benign Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gm9932 A T 5: 100,198,935 unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jmjd1c T A 10: 67,240,084 probably benign Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1552:Jarid2 UTSW 13 44911199 missense probably damaging 1.00
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1844:Jarid2 UTSW 13 44902743 missense possibly damaging 0.71
R1896:Jarid2 UTSW 13 44884882 critical splice donor site probably null
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4128:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6619:Jarid2 UTSW 13 44874396 missense probably damaging 1.00
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R6970:Jarid2 UTSW 13 44902985 missense probably damaging 1.00
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7223:Jarid2 UTSW 13 44896322 missense possibly damaging 0.89
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
R8321:Jarid2 UTSW 13 44848386 missense probably damaging 0.96
R8872:Jarid2 UTSW 13 44902508 missense possibly damaging 0.88
R9064:Jarid2 UTSW 13 44840850 missense
R9065:Jarid2 UTSW 13 44840850 missense
R9067:Jarid2 UTSW 13 44840850 missense
R9153:Jarid2 UTSW 13 44911202 missense probably damaging 1.00
R9163:Jarid2 UTSW 13 44911251 missense possibly damaging 0.92
R9468:Jarid2 UTSW 13 44919830 missense probably damaging 1.00
R9541:Jarid2 UTSW 13 44914777 missense possibly damaging 0.93
R9558:Jarid2 UTSW 13 44914777 missense possibly damaging 0.93
R9559:Jarid2 UTSW 13 44914777 missense possibly damaging 0.93
R9762:Jarid2 UTSW 13 44914777 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTTTGTACATACAAGCTGGCTGC -3'
(R):5'- AACTTGTGGTGGTCGCTCTC -3'

Sequencing Primer
(F):5'- GCTGCTGGCTGCTTTAGAG -3'
(R):5'- CGTGTGCCCCTCTAATGG -3'
Posted On 2015-02-05