Incidental Mutation 'R3113:Flrt3'
ID263865
Institutional Source Beutler Lab
Gene Symbol Flrt3
Ensembl Gene ENSMUSG00000051379
Gene Namefibronectin leucine rich transmembrane protein 3
Synonyms5530600M07Rik, C430047I10Rik
MMRRC Submission 040586-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3113 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140650914-140671469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140661534 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 58 (E58G)
Ref Sequence ENSEMBL: ENSMUSP00000105684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056760] [ENSMUST00000078027] [ENSMUST00000110057] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect probably benign
Transcript: ENSMUST00000056760
AA Change: E58G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053399
Gene: ENSMUSG00000051379
AA Change: E58G

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078027
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110057
AA Change: E58G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105684
Gene: ENSMUSG00000051379
AA Change: E58G

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110063
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172544
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRTs may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. This gene is expressed in many tissues. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, abnormal embryonic tissue development, disrupted head formation, cardia bifida and abnormal ventral wall closure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik G T 7: 139,975,965 probably benign Het
9330159F19Rik T A 10: 29,224,376 Y248* probably null Het
Acta2 T C 19: 34,243,352 I319V probably benign Het
Alox15 A T 11: 70,344,877 N585K probably benign Het
Ank T A 15: 27,571,614 I324N probably damaging Het
Ank1 A G 8: 23,084,797 N99D probably damaging Het
As3mt T C 19: 46,715,278 probably benign Het
Atg4b C T 1: 93,775,704 probably benign Het
Atp2a1 A T 7: 126,448,369 V705D probably damaging Het
Bves T C 10: 45,343,052 V82A probably benign Het
Cad C A 5: 31,074,137 H7Q possibly damaging Het
Carmil1 A G 13: 24,069,757 V387A probably benign Het
Csnk2a1 T A 2: 152,263,214 F181Y probably damaging Het
Cwc22 A T 2: 77,924,479 probably benign Het
Ddx18 A G 1: 121,566,148 S36P possibly damaging Het
Dnaic2 T A 11: 114,751,930 probably null Het
Ehbp1l1 A T 19: 5,718,980 M765K probably benign Het
Fitm2 T C 2: 163,469,591 Y234C probably damaging Het
Foxs1 A G 2: 152,932,236 V299A probably benign Het
Galnt12 A G 4: 47,108,415 N184S probably benign Het
Gata6 T C 18: 11,063,124 L464P probably damaging Het
Gm17332 T C 11: 31,182,384 T27A possibly damaging Het
Ifna11 A C 4: 88,819,983 M9L probably benign Het
Ldb3 T A 14: 34,529,461 *623L probably null Het
Lrrc27 A G 7: 139,218,307 D106G probably damaging Het
Ly6f A G 15: 75,271,728 N95D probably benign Het
Lyst A G 13: 13,669,927 I1901V probably benign Het
Mboat2 A G 12: 24,882,719 Y70C probably damaging Het
Mroh1 T A 15: 76,408,536 probably benign Het
Muc5b A G 7: 141,846,134 H448R unknown Het
Mut G A 17: 40,958,356 G610D probably damaging Het
Myh2 A G 11: 67,185,186 N733S probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nlrp1a A T 11: 71,123,665 I253N probably damaging Het
Ocrl A G X: 47,933,427 E258G probably benign Het
Olfr263 T A 13: 21,133,129 M118K probably damaging Het
Olfr791 A T 10: 129,527,143 R305S probably benign Het
Pak1 C A 7: 97,866,114 S115* probably null Het
Pilrb1 C T 5: 137,854,933 V203I possibly damaging Het
Ppfia2 T A 10: 106,906,395 Y1016* probably null Het
Prmt3 C A 7: 49,782,012 P121Q probably damaging Het
Rhox6 T A X: 37,827,630 I116N possibly damaging Het
Saxo2 A C 7: 82,643,741 F49L probably benign Het
Scn2a A C 2: 65,748,785 D1488A possibly damaging Het
Scn5a T A 9: 119,485,672 D1989V probably damaging Het
Sec31b C A 19: 44,518,185 E905* probably null Het
Secisbp2l A T 2: 125,750,286 F672I probably damaging Het
Slc22a23 C T 13: 34,183,075 G650E probably damaging Het
Smu1 A G 4: 40,748,658 F211L probably benign Het
Tab1 C T 15: 80,148,260 L23F probably benign Het
Thsd7b G A 1: 130,049,862 C1078Y probably benign Het
Ttn A T 2: 76,814,198 Y13071N probably damaging Het
Usp17ld A G 7: 103,250,663 V354A probably benign Het
Usp31 A G 7: 121,679,513 S210P probably damaging Het
Wdr12 T C 1: 60,087,062 D198G probably benign Het
Wrap53 A G 11: 69,563,318 V298A probably benign Het
Xirp2 A G 2: 67,510,147 I911V probably benign Het
Zcchc2 T C 1: 105,991,022 M78T unknown Het
Other mutations in Flrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Flrt3 APN 2 140660688 missense probably damaging 0.99
IGL02292:Flrt3 APN 2 140660125 missense probably damaging 1.00
R0030:Flrt3 UTSW 2 140660317 missense probably damaging 1.00
R1487:Flrt3 UTSW 2 140660934 missense probably damaging 1.00
R2061:Flrt3 UTSW 2 140661453 missense probably damaging 1.00
R2115:Flrt3 UTSW 2 140661503 missense probably damaging 1.00
R2326:Flrt3 UTSW 2 140661391 missense possibly damaging 0.50
R3605:Flrt3 UTSW 2 140661367 missense probably damaging 1.00
R4366:Flrt3 UTSW 2 140660407 missense probably damaging 0.99
R4702:Flrt3 UTSW 2 140661655 missense probably benign
R4799:Flrt3 UTSW 2 140660166 missense probably damaging 1.00
R5085:Flrt3 UTSW 2 140660257 missense probably damaging 0.99
R5100:Flrt3 UTSW 2 140671384 start gained probably null
R5109:Flrt3 UTSW 2 140660743 missense possibly damaging 0.51
R5635:Flrt3 UTSW 2 140660500 missense probably damaging 1.00
R5982:Flrt3 UTSW 2 140660916 missense possibly damaging 0.95
R6117:Flrt3 UTSW 2 140660445 missense possibly damaging 0.46
R6213:Flrt3 UTSW 2 140661165 missense probably damaging 1.00
R6246:Flrt3 UTSW 2 140659801 missense probably damaging 1.00
R6746:Flrt3 UTSW 2 140660025 missense probably damaging 0.99
R6854:Flrt3 UTSW 2 140660718 missense probably damaging 1.00
R7000:Flrt3 UTSW 2 140660884 nonsense probably null
R7221:Flrt3 UTSW 2 140661170 missense probably damaging 0.99
R7388:Flrt3 UTSW 2 140661752 critical splice acceptor site probably null
R7444:Flrt3 UTSW 2 140660467 missense probably benign 0.00
R7526:Flrt3 UTSW 2 140660206 missense probably damaging 1.00
R7967:Flrt3 UTSW 2 140659891 nonsense probably null
R8272:Flrt3 UTSW 2 140660697 missense probably damaging 1.00
R8441:Flrt3 UTSW 2 140660626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTTCCAGATACGGAATTTTCG -3'
(R):5'- ACTGCTGACCATGATCAGCC -3'

Sequencing Primer
(F):5'- CCAGATACGGAATTTTCGAAAGTG -3'
(R):5'- ATGATCAGCCCAGCCTGGAG -3'
Posted On2015-02-05