Incidental Mutation 'R3113:Bves'
ID 263886
Institutional Source Beutler Lab
Gene Symbol Bves
Ensembl Gene ENSMUSG00000071317
Gene Name blood vessel epicardial substance
Synonyms Popdc1, popeye 1
MMRRC Submission 040586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3113 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 45335772-45372479 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45343052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 82 (V82A)
Ref Sequence ENSEMBL: ENSMUSP00000093382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095715]
AlphaFold Q9ES83
Predicted Effect probably benign
Transcript: ENSMUST00000095715
AA Change: V82A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000093382
Gene: ENSMUSG00000071317
AA Change: V82A

DomainStartEndE-ValueType
Pfam:Popeye 40 267 3e-90 PFAM
low complexity region 313 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in development of these tissues. The mouse ortholog may be involved in the regeneration of adult skeletal muscle and may act as a cell adhesion molecule in coronary vasculogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in delayed muscle regeneration following induced injury. Mice homozygous for a knock-out allele exhibit sinus brachycardia in response to physical or mental stress and catecholamines with a compact sinoatrial node. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik G T 7: 139,975,965 probably benign Het
9330159F19Rik T A 10: 29,224,376 Y248* probably null Het
Acta2 T C 19: 34,243,352 I319V probably benign Het
Alox15 A T 11: 70,344,877 N585K probably benign Het
Ank T A 15: 27,571,614 I324N probably damaging Het
Ank1 A G 8: 23,084,797 N99D probably damaging Het
As3mt T C 19: 46,715,278 probably benign Het
Atg4b C T 1: 93,775,704 probably benign Het
Atp2a1 A T 7: 126,448,369 V705D probably damaging Het
Cad C A 5: 31,074,137 H7Q possibly damaging Het
Carmil1 A G 13: 24,069,757 V387A probably benign Het
Csnk2a1 T A 2: 152,263,214 F181Y probably damaging Het
Cwc22 A T 2: 77,924,479 probably benign Het
Ddx18 A G 1: 121,566,148 S36P possibly damaging Het
Dnaic2 T A 11: 114,751,930 probably null Het
Ehbp1l1 A T 19: 5,718,980 M765K probably benign Het
Fitm2 T C 2: 163,469,591 Y234C probably damaging Het
Flrt3 T C 2: 140,661,534 E58G probably benign Het
Foxs1 A G 2: 152,932,236 V299A probably benign Het
Galnt12 A G 4: 47,108,415 N184S probably benign Het
Gata6 T C 18: 11,063,124 L464P probably damaging Het
Gm17332 T C 11: 31,182,384 T27A possibly damaging Het
Ifna11 A C 4: 88,819,983 M9L probably benign Het
Ldb3 T A 14: 34,529,461 *623L probably null Het
Lrrc27 A G 7: 139,218,307 D106G probably damaging Het
Ly6f A G 15: 75,271,728 N95D probably benign Het
Lyst A G 13: 13,669,927 I1901V probably benign Het
Mboat2 A G 12: 24,882,719 Y70C probably damaging Het
Mroh1 T A 15: 76,408,536 probably benign Het
Muc5b A G 7: 141,846,134 H448R unknown Het
Mut G A 17: 40,958,356 G610D probably damaging Het
Myh2 A G 11: 67,185,186 N733S probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nlrp1a A T 11: 71,123,665 I253N probably damaging Het
Ocrl A G X: 47,933,427 E258G probably benign Het
Olfr263 T A 13: 21,133,129 M118K probably damaging Het
Olfr791 A T 10: 129,527,143 R305S probably benign Het
Pak1 C A 7: 97,866,114 S115* probably null Het
Pilrb1 C T 5: 137,854,933 V203I possibly damaging Het
Ppfia2 T A 10: 106,906,395 Y1016* probably null Het
Prmt3 C A 7: 49,782,012 P121Q probably damaging Het
Rhox6 T A X: 37,827,630 I116N possibly damaging Het
Saxo2 A C 7: 82,643,741 F49L probably benign Het
Scn2a A C 2: 65,748,785 D1488A possibly damaging Het
Scn5a T A 9: 119,485,672 D1989V probably damaging Het
Sec31b C A 19: 44,518,185 E905* probably null Het
Secisbp2l A T 2: 125,750,286 F672I probably damaging Het
Slc22a23 C T 13: 34,183,075 G650E probably damaging Het
Smu1 A G 4: 40,748,658 F211L probably benign Het
Tab1 C T 15: 80,148,260 L23F probably benign Het
Thsd7b G A 1: 130,049,862 C1078Y probably benign Het
Ttn A T 2: 76,814,198 Y13071N probably damaging Het
Usp17ld A G 7: 103,250,663 V354A probably benign Het
Usp31 A G 7: 121,679,513 S210P probably damaging Het
Wdr12 T C 1: 60,087,062 D198G probably benign Het
Wrap53 A G 11: 69,563,318 V298A probably benign Het
Xirp2 A G 2: 67,510,147 I911V probably benign Het
Zcchc2 T C 1: 105,991,022 M78T unknown Het
Other mutations in Bves
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Bves APN 10 45353848 missense probably damaging 1.00
IGL01155:Bves APN 10 45353859 missense probably damaging 1.00
IGL01482:Bves APN 10 45354806 missense possibly damaging 0.68
R1402:Bves UTSW 10 45347865 missense probably damaging 1.00
R1402:Bves UTSW 10 45347865 missense probably damaging 1.00
R1564:Bves UTSW 10 45369281 missense probably benign 0.03
R1711:Bves UTSW 10 45347865 missense probably damaging 1.00
R1742:Bves UTSW 10 45347865 missense probably damaging 1.00
R2057:Bves UTSW 10 45343135 missense probably damaging 1.00
R3546:Bves UTSW 10 45354811 missense probably damaging 1.00
R4400:Bves UTSW 10 45369293 missense probably benign
R4612:Bves UTSW 10 45339277 missense probably benign 0.01
R4687:Bves UTSW 10 45354840 splice site probably null
R6994:Bves UTSW 10 45339418 missense probably benign
R7052:Bves UTSW 10 45346290 missense possibly damaging 0.69
R7179:Bves UTSW 10 45354817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACACCAGTACTGAATTGTC -3'
(R):5'- GGTGCTCACATGCAAGTCTG -3'

Sequencing Primer
(F):5'- ACTACATAGTGAGACCCTGTCTTGG -3'
(R):5'- TGCTCACATGCAAGTCTGAATGAAG -3'
Posted On 2015-02-05