Incidental Mutation 'R0324:Robo2'
ID26389
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 038534-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73967851 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 630 (V630M)
Ref Sequence ENSEMBL: ENSMUSP00000112776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect possibly damaging
Transcript: ENSMUST00000116586
AA Change: V634M

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: V634M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117200
AA Change: V630M

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: V630M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117785
AA Change: V630M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: V630M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226478
AA Change: V634M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227347
AA Change: V634M

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1195:Robo2 UTSW 16 73916128 splice site probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
R7192:Robo2 UTSW 16 73920750 missense probably benign 0.19
R7569:Robo2 UTSW 16 74035115 missense possibly damaging 0.82
R7686:Robo2 UTSW 16 73958405 missense probably damaging 1.00
R7720:Robo2 UTSW 16 73897015 missense probably benign 0.00
R7772:Robo2 UTSW 16 73961889 missense probably benign 0.24
R7822:Robo2 UTSW 16 73973171 missense probably damaging 1.00
R7849:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R7881:Robo2 UTSW 16 73920697 missense probably benign 0.00
R7897:Robo2 UTSW 16 73898950 missense probably benign
R8135:Robo2 UTSW 16 73933160 missense probably benign 0.04
R8297:Robo2 UTSW 16 74015926 nonsense probably null
R8307:Robo2 UTSW 16 73956610 missense probably damaging 1.00
R8379:Robo2 UTSW 16 73933700 missense probably damaging 0.99
R8393:Robo2 UTSW 16 73978494 missense probably damaging 1.00
R8474:Robo2 UTSW 16 73948262 missense probably damaging 1.00
R8500:Robo2 UTSW 16 73948340 missense probably damaging 1.00
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Z1176:Robo2 UTSW 16 73933591 missense probably benign 0.35
Z1177:Robo2 UTSW 16 73940299 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGTAACTTTCGCATGTTGACTGC -3'
(R):5'- CGGAAAATACTTCAGGGCCTCATCATC -3'

Sequencing Primer
(F):5'- GCCAGGAAGGTTAGACTTCTATTTC -3'
(R):5'- AGGGTACAGTCTCTACTCTAACTCAG -3'
Posted On2013-04-16