Incidental Mutation 'R0324:1700010I14Rik'
Institutional Source Beutler Lab
Gene Symbol 1700010I14Rik
Ensembl Gene ENSMUSG00000023873
Gene NameRIKEN cDNA 1700010I14 gene
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0324 (G1)
Quality Score202
Status Not validated
Chromosomal Location8988333-9008319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9001157 bp
Amino Acid Change Leucine to Serine at position 357 (L357S)
Ref Sequence ENSEMBL: ENSMUSP00000118841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024650] [ENSMUST00000151609]
Predicted Effect probably benign
Transcript: ENSMUST00000024650
AA Change: L357S

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024650
Gene: ENSMUSG00000023873
AA Change: L357S

coiled coil region 135 165 N/A INTRINSIC
Pfam:TSNAXIP1_N 239 349 6.1e-36 PFAM
low complexity region 351 364 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
low complexity region 501 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136954
Predicted Effect probably benign
Transcript: ENSMUST00000151609
AA Change: L357S

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118841
Gene: ENSMUSG00000023873
AA Change: L357S

coiled coil region 135 165 N/A INTRINSIC
coiled coil region 321 370 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in 1700010I14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:1700010I14Rik APN 17 8997105 critical splice donor site probably null
IGL01569:1700010I14Rik APN 17 8996995 missense probably benign 0.33
IGL03024:1700010I14Rik APN 17 8993632 missense probably benign 0.33
IGL03410:1700010I14Rik APN 17 9001896 missense probably damaging 1.00
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0361:1700010I14Rik UTSW 17 8992546 missense probably benign 0.39
R0482:1700010I14Rik UTSW 17 8988423 critical splice donor site probably null
R0529:1700010I14Rik UTSW 17 8992396 missense probably benign 0.32
R1102:1700010I14Rik UTSW 17 8992628 missense probably damaging 1.00
R1964:1700010I14Rik UTSW 17 8992492 missense probably damaging 0.99
R3620:1700010I14Rik UTSW 17 9008032 missense probably benign 0.15
R4259:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4261:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4687:1700010I14Rik UTSW 17 8992153 missense probably damaging 1.00
R4707:1700010I14Rik UTSW 17 9005712 missense probably damaging 1.00
R4839:1700010I14Rik UTSW 17 9008013 missense probably benign 0.41
R4979:1700010I14Rik UTSW 17 9001811 missense probably damaging 1.00
R5225:1700010I14Rik UTSW 17 9008007 nonsense probably null
R5383:1700010I14Rik UTSW 17 8992700 missense possibly damaging 0.86
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6505:1700010I14Rik UTSW 17 9001940 missense probably benign 0.08
R6736:1700010I14Rik UTSW 17 8992268 missense probably benign 0.01
R7089:1700010I14Rik UTSW 17 9008095 missense probably benign 0.00
R7097:1700010I14Rik UTSW 17 9005220 missense probably damaging 1.00
R7292:1700010I14Rik UTSW 17 8997029 nonsense probably null
R7405:1700010I14Rik UTSW 17 9001817 missense probably damaging 0.99
R7567:1700010I14Rik UTSW 17 9008006 missense probably damaging 1.00
R7877:1700010I14Rik UTSW 17 9001833 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acacacacacatacatacacatac -3'
Posted On2013-04-16