Incidental Mutation 'R3113:Carmil1'
ID263900
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission 040586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3113 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24069757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 387 (V387A)
Ref Sequence ENSEMBL: ENSMUSP00000126522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000125901]
Predicted Effect probably benign
Transcript: ENSMUST00000072889
AA Change: V797A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: V797A

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110398
AA Change: V793A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338
AA Change: V793A

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125901
AA Change: V387A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126522
Gene: ENSMUSG00000021338
AA Change: V387A

DomainStartEndE-ValueType
Blast:LRR 13 40 5e-8 BLAST
Blast:LRR 41 74 4e-9 BLAST
Pfam:LRR_6 75 101 4.4e-2 PFAM
Pfam:LRR_6 164 187 1.6e-3 PFAM
Blast:LRR 192 219 7e-10 BLAST
low complexity region 335 348 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
PDB:3LK3|T 564 676 4e-57 PDB
low complexity region 727 743 N/A INTRINSIC
low complexity region 841 847 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
low complexity region 883 892 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142171
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik G T 7: 139,975,965 probably benign Het
9330159F19Rik T A 10: 29,224,376 Y248* probably null Het
Acta2 T C 19: 34,243,352 I319V probably benign Het
Alox15 A T 11: 70,344,877 N585K probably benign Het
Ank T A 15: 27,571,614 I324N probably damaging Het
Ank1 A G 8: 23,084,797 N99D probably damaging Het
As3mt T C 19: 46,715,278 probably benign Het
Atg4b C T 1: 93,775,704 probably benign Het
Atp2a1 A T 7: 126,448,369 V705D probably damaging Het
Bves T C 10: 45,343,052 V82A probably benign Het
Cad C A 5: 31,074,137 H7Q possibly damaging Het
Csnk2a1 T A 2: 152,263,214 F181Y probably damaging Het
Cwc22 A T 2: 77,924,479 probably benign Het
Ddx18 A G 1: 121,566,148 S36P possibly damaging Het
Dnaic2 T A 11: 114,751,930 probably null Het
Ehbp1l1 A T 19: 5,718,980 M765K probably benign Het
Fitm2 T C 2: 163,469,591 Y234C probably damaging Het
Flrt3 T C 2: 140,661,534 E58G probably benign Het
Foxs1 A G 2: 152,932,236 V299A probably benign Het
Galnt12 A G 4: 47,108,415 N184S probably benign Het
Gata6 T C 18: 11,063,124 L464P probably damaging Het
Gm17332 T C 11: 31,182,384 T27A possibly damaging Het
Ifna11 A C 4: 88,819,983 M9L probably benign Het
Ldb3 T A 14: 34,529,461 *623L probably null Het
Lrrc27 A G 7: 139,218,307 D106G probably damaging Het
Ly6f A G 15: 75,271,728 N95D probably benign Het
Lyst A G 13: 13,669,927 I1901V probably benign Het
Mboat2 A G 12: 24,882,719 Y70C probably damaging Het
Mroh1 T A 15: 76,408,536 probably benign Het
Muc5b A G 7: 141,846,134 H448R unknown Het
Mut G A 17: 40,958,356 G610D probably damaging Het
Myh2 A G 11: 67,185,186 N733S probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nlrp1a A T 11: 71,123,665 I253N probably damaging Het
Ocrl A G X: 47,933,427 E258G probably benign Het
Olfr263 T A 13: 21,133,129 M118K probably damaging Het
Olfr791 A T 10: 129,527,143 R305S probably benign Het
Pak1 C A 7: 97,866,114 S115* probably null Het
Pilrb1 C T 5: 137,854,933 V203I possibly damaging Het
Ppfia2 T A 10: 106,906,395 Y1016* probably null Het
Prmt3 C A 7: 49,782,012 P121Q probably damaging Het
Rhox6 T A X: 37,827,630 I116N possibly damaging Het
Saxo2 A C 7: 82,643,741 F49L probably benign Het
Scn2a A C 2: 65,748,785 D1488A possibly damaging Het
Scn5a T A 9: 119,485,672 D1989V probably damaging Het
Sec31b C A 19: 44,518,185 E905* probably null Het
Secisbp2l A T 2: 125,750,286 F672I probably damaging Het
Slc22a23 C T 13: 34,183,075 G650E probably damaging Het
Smu1 A G 4: 40,748,658 F211L probably benign Het
Tab1 C T 15: 80,148,260 L23F probably benign Het
Thsd7b G A 1: 130,049,862 C1078Y probably benign Het
Ttn A T 2: 76,814,198 Y13071N probably damaging Het
Usp17ld A G 7: 103,250,663 V354A probably benign Het
Usp31 A G 7: 121,679,513 S210P probably damaging Het
Wdr12 T C 1: 60,087,062 D198G probably benign Het
Wrap53 A G 11: 69,563,318 V298A probably benign Het
Xirp2 A G 2: 67,510,147 I911V probably benign Het
Zcchc2 T C 1: 105,991,022 M78T unknown Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2099:Carmil1 UTSW 13 24173667 missense probably benign 0.00
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R3954:Carmil1 UTSW 13 24013407 missense probably benign 0.00
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5496:Carmil1 UTSW 13 24155450 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5789:Carmil1 UTSW 13 24121848 missense probably damaging 1.00
R5794:Carmil1 UTSW 13 24092550 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6127:Carmil1 UTSW 13 24036352 missense probably benign 0.03
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
R7179:Carmil1 UTSW 13 24020069 missense probably benign 0.00
R7282:Carmil1 UTSW 13 24013404 missense probably benign
R7286:Carmil1 UTSW 13 24013394 missense probably damaging 0.96
R7397:Carmil1 UTSW 13 24044311 missense probably damaging 0.99
R7412:Carmil1 UTSW 13 24098810 missense possibly damaging 0.50
R7611:Carmil1 UTSW 13 24013332 missense probably benign 0.30
R7642:Carmil1 UTSW 13 24067206 missense probably benign 0.12
R7827:Carmil1 UTSW 13 24036438 missense probably benign 0.00
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTGTGGCTCACATACTGCAG -3'
(R):5'- ACGGCTGCTCTAAAGAGATTCC -3'

Sequencing Primer
(F):5'- GCTCCTTAGCTTAGTACCATGATGAC -3'
(R):5'- GGCTGCTCTAAAGAGATTCCTTCAG -3'
Posted On2015-02-05