Incidental Mutation 'R3113:Mut'
ID263909
Institutional Source Beutler Lab
Gene Symbol Mut
Ensembl Gene ENSMUSG00000023921
Gene Namemethylmalonyl-Coenzyme A mutase
Synonyms
MMRRC Submission 040586-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3113 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40934685-40961989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40958356 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 610 (G610D)
Ref Sequence ENSEMBL: ENSMUSP00000130941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169611]
Predicted Effect probably damaging
Transcript: ENSMUST00000169611
AA Change: G610D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: G610D

DomainStartEndE-ValueType
Pfam:MM_CoA_mutase 60 572 3.7e-240 PFAM
Pfam:B12-binding 613 731 4.7e-17 PFAM
Meta Mutation Damage Score 0.3823 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik G T 7: 139,975,965 probably benign Het
9330159F19Rik T A 10: 29,224,376 Y248* probably null Het
Acta2 T C 19: 34,243,352 I319V probably benign Het
Alox15 A T 11: 70,344,877 N585K probably benign Het
Ank T A 15: 27,571,614 I324N probably damaging Het
Ank1 A G 8: 23,084,797 N99D probably damaging Het
As3mt T C 19: 46,715,278 probably benign Het
Atg4b C T 1: 93,775,704 probably benign Het
Atp2a1 A T 7: 126,448,369 V705D probably damaging Het
Bves T C 10: 45,343,052 V82A probably benign Het
Cad C A 5: 31,074,137 H7Q possibly damaging Het
Carmil1 A G 13: 24,069,757 V387A probably benign Het
Csnk2a1 T A 2: 152,263,214 F181Y probably damaging Het
Cwc22 A T 2: 77,924,479 probably benign Het
Ddx18 A G 1: 121,566,148 S36P possibly damaging Het
Dnaic2 T A 11: 114,751,930 probably null Het
Ehbp1l1 A T 19: 5,718,980 M765K probably benign Het
Fitm2 T C 2: 163,469,591 Y234C probably damaging Het
Flrt3 T C 2: 140,661,534 E58G probably benign Het
Foxs1 A G 2: 152,932,236 V299A probably benign Het
Galnt12 A G 4: 47,108,415 N184S probably benign Het
Gata6 T C 18: 11,063,124 L464P probably damaging Het
Gm17332 T C 11: 31,182,384 T27A possibly damaging Het
Ifna11 A C 4: 88,819,983 M9L probably benign Het
Ldb3 T A 14: 34,529,461 *623L probably null Het
Lrrc27 A G 7: 139,218,307 D106G probably damaging Het
Ly6f A G 15: 75,271,728 N95D probably benign Het
Lyst A G 13: 13,669,927 I1901V probably benign Het
Mboat2 A G 12: 24,882,719 Y70C probably damaging Het
Mroh1 T A 15: 76,408,536 probably benign Het
Muc5b A G 7: 141,846,134 H448R unknown Het
Myh2 A G 11: 67,185,186 N733S probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nlrp1a A T 11: 71,123,665 I253N probably damaging Het
Ocrl A G X: 47,933,427 E258G probably benign Het
Olfr263 T A 13: 21,133,129 M118K probably damaging Het
Olfr791 A T 10: 129,527,143 R305S probably benign Het
Pak1 C A 7: 97,866,114 S115* probably null Het
Pilrb1 C T 5: 137,854,933 V203I possibly damaging Het
Ppfia2 T A 10: 106,906,395 Y1016* probably null Het
Prmt3 C A 7: 49,782,012 P121Q probably damaging Het
Rhox6 T A X: 37,827,630 I116N possibly damaging Het
Saxo2 A C 7: 82,643,741 F49L probably benign Het
Scn2a A C 2: 65,748,785 D1488A possibly damaging Het
Scn5a T A 9: 119,485,672 D1989V probably damaging Het
Sec31b C A 19: 44,518,185 E905* probably null Het
Secisbp2l A T 2: 125,750,286 F672I probably damaging Het
Slc22a23 C T 13: 34,183,075 G650E probably damaging Het
Smu1 A G 4: 40,748,658 F211L probably benign Het
Tab1 C T 15: 80,148,260 L23F probably benign Het
Thsd7b G A 1: 130,049,862 C1078Y probably benign Het
Ttn A T 2: 76,814,198 Y13071N probably damaging Het
Usp17ld A G 7: 103,250,663 V354A probably benign Het
Usp31 A G 7: 121,679,513 S210P probably damaging Het
Wdr12 T C 1: 60,087,062 D198G probably benign Het
Wrap53 A G 11: 69,563,318 V298A probably benign Het
Xirp2 A G 2: 67,510,147 I911V probably benign Het
Zcchc2 T C 1: 105,991,022 M78T unknown Het
Other mutations in Mut
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Mut APN 17 40956271 missense probably damaging 0.99
IGL01666:Mut APN 17 40958811 missense probably damaging 1.00
IGL02141:Mut APN 17 40938817 missense possibly damaging 0.68
IGL02257:Mut APN 17 40938734 missense possibly damaging 0.78
IGL02538:Mut APN 17 40938619 missense probably damaging 1.00
mix UTSW 17 40941383 missense possibly damaging 0.66
mongrel UTSW 17 40938731 missense possibly damaging 0.77
R0115:Mut UTSW 17 40956227 missense probably damaging 1.00
R0381:Mut UTSW 17 40937258 missense probably benign 0.04
R0603:Mut UTSW 17 40947166 missense probably damaging 0.99
R0928:Mut UTSW 17 40937283 missense probably benign 0.24
R1292:Mut UTSW 17 40941407 missense probably damaging 1.00
R1452:Mut UTSW 17 40937468 splice site probably benign
R1460:Mut UTSW 17 40937375 missense probably damaging 1.00
R2044:Mut UTSW 17 40941451 missense probably benign 0.00
R2256:Mut UTSW 17 40956319 missense probably benign 0.02
R2448:Mut UTSW 17 40958841 missense probably damaging 0.96
R3176:Mut UTSW 17 40958872 splice site probably null
R3276:Mut UTSW 17 40958872 splice site probably null
R3894:Mut UTSW 17 40955139 missense probably damaging 0.97
R4624:Mut UTSW 17 40947055 missense probably damaging 1.00
R4801:Mut UTSW 17 40937351 missense probably benign 0.08
R4802:Mut UTSW 17 40937351 missense probably benign 0.08
R5031:Mut UTSW 17 40938827 missense possibly damaging 0.96
R5394:Mut UTSW 17 40947184 missense probably benign 0.02
R5651:Mut UTSW 17 40947111 missense probably damaging 1.00
R6225:Mut UTSW 17 40938731 missense possibly damaging 0.77
R6274:Mut UTSW 17 40956245 missense probably benign 0.00
R7002:Mut UTSW 17 40941383 missense possibly damaging 0.66
R7141:Mut UTSW 17 40952839 missense possibly damaging 0.68
R7203:Mut UTSW 17 40938673 missense probably benign 0.06
R7868:Mut UTSW 17 40947043 missense probably damaging 1.00
R8050:Mut UTSW 17 40943893 missense probably benign 0.06
R8228:Mut UTSW 17 40937328 missense possibly damaging 0.92
RF021:Mut UTSW 17 40951758 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCCATCTTTGAAATGTGGCTC -3'
(R):5'- ATCCTGCACATCACCTTGGC -3'

Sequencing Primer
(F):5'- TGTGGCTCTAAACAGAAGCC -3'
(R):5'- GCACATCACCTTGGCTATTATTTAC -3'
Posted On2015-02-05