Incidental Mutation 'R3113:Gata6'
ID 263910
Institutional Source Beutler Lab
Gene Symbol Gata6
Ensembl Gene ENSMUSG00000005836
Gene Name GATA binding protein 6
Synonyms
MMRRC Submission 040586-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3113 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 11052510-11085636 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11063124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 464 (L464P)
Ref Sequence ENSEMBL: ENSMUSP00000041774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047762]
AlphaFold Q61169
Predicted Effect probably damaging
Transcript: ENSMUST00000047762
AA Change: L464P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: L464P

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 84 105 N/A INTRINSIC
Pfam:GATA-N 147 372 2.3e-62 PFAM
ZnF_GATA 378 429 4.23e-16 SMART
ZnF_GATA 432 482 3.62e-24 SMART
Meta Mutation Damage Score 0.9743 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,100,372 (GRCm39) Y248* probably null Het
Acta2 T C 19: 34,220,752 (GRCm39) I319V probably benign Het
Alox15 A T 11: 70,235,703 (GRCm39) N585K probably benign Het
Ank T A 15: 27,571,700 (GRCm39) I324N probably damaging Het
Ank1 A G 8: 23,574,813 (GRCm39) N99D probably damaging Het
As3mt T C 19: 46,703,717 (GRCm39) probably benign Het
Atg4b C T 1: 93,703,426 (GRCm39) probably benign Het
Atp2a1 A T 7: 126,047,541 (GRCm39) V705D probably damaging Het
Bves T C 10: 45,219,148 (GRCm39) V82A probably benign Het
Cad C A 5: 31,231,481 (GRCm39) H7Q possibly damaging Het
Carmil1 A G 13: 24,253,740 (GRCm39) V387A probably benign Het
Csnk2a1 T A 2: 152,105,134 (GRCm39) F181Y probably damaging Het
Cwc22 A T 2: 77,754,823 (GRCm39) probably benign Het
Ddx18 A G 1: 121,493,877 (GRCm39) S36P possibly damaging Het
Dnai2 T A 11: 114,642,756 (GRCm39) probably null Het
Ehbp1l1 A T 19: 5,769,008 (GRCm39) M765K probably benign Het
Fitm2 T C 2: 163,311,511 (GRCm39) Y234C probably damaging Het
Flrt3 T C 2: 140,503,454 (GRCm39) E58G probably benign Het
Foxs1 A G 2: 152,774,156 (GRCm39) V299A probably benign Het
Galnt12 A G 4: 47,108,415 (GRCm39) N184S probably benign Het
Gm17332 T C 11: 31,132,384 (GRCm39) T27A possibly damaging Het
Ifna11 A C 4: 88,738,220 (GRCm39) M9L probably benign Het
Ldb3 T A 14: 34,251,418 (GRCm39) *623L probably null Het
Lrrc27 A G 7: 138,798,223 (GRCm39) D106G probably damaging Het
Ly6f A G 15: 75,143,577 (GRCm39) N95D probably benign Het
Lyst A G 13: 13,844,512 (GRCm39) I1901V probably benign Het
Mboat2 A G 12: 24,932,718 (GRCm39) Y70C probably damaging Het
Mmut G A 17: 41,269,247 (GRCm39) G610D probably damaging Het
Mroh1 T A 15: 76,292,736 (GRCm39) probably benign Het
Muc5b A G 7: 141,399,871 (GRCm39) H448R unknown Het
Myh2 A G 11: 67,076,012 (GRCm39) N733S probably damaging Het
Nid2 G A 14: 19,828,111 (GRCm39) G516S probably benign Het
Nlrp1a A T 11: 71,014,491 (GRCm39) I253N probably damaging Het
Ocrl A G X: 47,022,304 (GRCm39) E258G probably benign Het
Or2w1 T A 13: 21,317,299 (GRCm39) M118K probably damaging Het
Or6c2 A T 10: 129,363,012 (GRCm39) R305S probably benign Het
Pak1 C A 7: 97,515,321 (GRCm39) S115* probably null Het
Pilrb1 C T 5: 137,853,195 (GRCm39) V203I possibly damaging Het
Ppfia2 T A 10: 106,742,256 (GRCm39) Y1016* probably null Het
Prmt3 C A 7: 49,431,760 (GRCm39) P121Q probably damaging Het
Rhox6 T A X: 36,916,507 (GRCm39) I116N possibly damaging Het
Saxo2 A C 7: 82,292,949 (GRCm39) F49L probably benign Het
Scn2a A C 2: 65,579,129 (GRCm39) D1488A possibly damaging Het
Scn5a T A 9: 119,314,738 (GRCm39) D1989V probably damaging Het
Sec31b C A 19: 44,506,624 (GRCm39) E905* probably null Het
Secisbp2l A T 2: 125,592,206 (GRCm39) F672I probably damaging Het
Slc22a23 C T 13: 34,367,058 (GRCm39) G650E probably damaging Het
Smu1 A G 4: 40,748,658 (GRCm39) F211L probably benign Het
Spef1l G T 7: 139,555,878 (GRCm39) probably benign Het
Tab1 C T 15: 80,032,461 (GRCm39) L23F probably benign Het
Thsd7b G A 1: 129,977,599 (GRCm39) C1078Y probably benign Het
Ttn A T 2: 76,644,542 (GRCm39) Y13071N probably damaging Het
Usp17ld A G 7: 102,899,870 (GRCm39) V354A probably benign Het
Usp31 A G 7: 121,278,736 (GRCm39) S210P probably damaging Het
Wdr12 T C 1: 60,126,221 (GRCm39) D198G probably benign Het
Wrap53 A G 11: 69,454,144 (GRCm39) V298A probably benign Het
Xirp2 A G 2: 67,340,491 (GRCm39) I911V probably benign Het
Zcchc2 T C 1: 105,918,752 (GRCm39) M78T unknown Het
Other mutations in Gata6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Gata6 APN 18 11,084,330 (GRCm39) missense possibly damaging 0.47
IGL01328:Gata6 APN 18 11,064,530 (GRCm39) missense probably damaging 0.99
IGL02419:Gata6 APN 18 11,054,220 (GRCm39) missense probably damaging 1.00
Lutsen UTSW 18 11,063,059 (GRCm39) missense possibly damaging 0.65
R0538:Gata6 UTSW 18 11,064,771 (GRCm39) missense probably benign 0.11
R1419:Gata6 UTSW 18 11,064,706 (GRCm39) missense probably benign 0.42
R2000:Gata6 UTSW 18 11,054,113 (GRCm39) missense probably benign 0.04
R4765:Gata6 UTSW 18 11,054,394 (GRCm39) missense probably benign
R4855:Gata6 UTSW 18 11,054,497 (GRCm39) missense possibly damaging 0.92
R5368:Gata6 UTSW 18 11,063,059 (GRCm39) missense possibly damaging 0.65
R6805:Gata6 UTSW 18 11,054,460 (GRCm39) missense possibly damaging 0.83
R7192:Gata6 UTSW 18 11,054,475 (GRCm39) missense possibly damaging 0.82
R7206:Gata6 UTSW 18 11,054,850 (GRCm39) missense probably damaging 1.00
R7501:Gata6 UTSW 18 11,054,082 (GRCm39) missense probably damaging 0.97
R7541:Gata6 UTSW 18 11,059,108 (GRCm39) missense probably damaging 1.00
R7736:Gata6 UTSW 18 11,084,379 (GRCm39) missense probably damaging 1.00
R8029:Gata6 UTSW 18 11,054,944 (GRCm39) missense possibly damaging 0.68
R8251:Gata6 UTSW 18 11,054,670 (GRCm39) missense probably benign 0.03
R9339:Gata6 UTSW 18 11,054,520 (GRCm39) missense probably damaging 0.98
R9712:Gata6 UTSW 18 11,059,064 (GRCm39) missense possibly damaging 0.68
R9753:Gata6 UTSW 18 11,064,706 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTAGTCCAGGAAGTCTGCC -3'
(R):5'- GCTGAACTGACTGGTCACATTAC -3'

Sequencing Primer
(F):5'- CCAGGAAGTCTGCCTAATTATATTTG -3'
(R):5'- CTGGTCACATTACAATTAAGAGCAGC -3'
Posted On 2015-02-05