Incidental Mutation 'R3113:Acta2'
ID263913
Institutional Source Beutler Lab
Gene Symbol Acta2
Ensembl Gene ENSMUSG00000035783
Gene Nameactin, alpha 2, smooth muscle, aorta
SynonymsalphaSMA, SMalphaA, 0610041G09Rik, Actvs, a-SMA
MMRRC Submission 040586-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R3113 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34241090-34255336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34243352 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 319 (I319V)
Ref Sequence ENSEMBL: ENSMUSP00000048218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631] [ENSMUST00000054956] [ENSMUST00000119603]
Predicted Effect probably benign
Transcript: ENSMUST00000039631
AA Change: I319V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783
AA Change: I319V

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054956
SMART Domains Protein: ENSMUSP00000059927
Gene: ENSMUSG00000024776

DomainStartEndE-ValueType
Pfam:USP8_dimer 19 132 3e-21 PFAM
coiled coil region 149 176 N/A INTRINSIC
JAB_MPN 268 394 4.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119603
SMART Domains Protein: ENSMUSP00000112938
Gene: ENSMUSG00000024776

DomainStartEndE-ValueType
Pfam:USP8_dimer 19 132 3.9e-21 PFAM
coiled coil region 149 176 N/A INTRINSIC
JAB_MPN 268 394 4.29e-13 SMART
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vascular contractility and blood pressure homeostasis, increased blood-retina barrier permeability, and reduced retinal cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik G T 7: 139,975,965 probably benign Het
9330159F19Rik T A 10: 29,224,376 Y248* probably null Het
Alox15 A T 11: 70,344,877 N585K probably benign Het
Ank T A 15: 27,571,614 I324N probably damaging Het
Ank1 A G 8: 23,084,797 N99D probably damaging Het
As3mt T C 19: 46,715,278 probably benign Het
Atg4b C T 1: 93,775,704 probably benign Het
Atp2a1 A T 7: 126,448,369 V705D probably damaging Het
Bves T C 10: 45,343,052 V82A probably benign Het
Cad C A 5: 31,074,137 H7Q possibly damaging Het
Carmil1 A G 13: 24,069,757 V387A probably benign Het
Csnk2a1 T A 2: 152,263,214 F181Y probably damaging Het
Cwc22 A T 2: 77,924,479 probably benign Het
Ddx18 A G 1: 121,566,148 S36P possibly damaging Het
Dnaic2 T A 11: 114,751,930 probably null Het
Ehbp1l1 A T 19: 5,718,980 M765K probably benign Het
Fitm2 T C 2: 163,469,591 Y234C probably damaging Het
Flrt3 T C 2: 140,661,534 E58G probably benign Het
Foxs1 A G 2: 152,932,236 V299A probably benign Het
Galnt12 A G 4: 47,108,415 N184S probably benign Het
Gata6 T C 18: 11,063,124 L464P probably damaging Het
Gm17332 T C 11: 31,182,384 T27A possibly damaging Het
Ifna11 A C 4: 88,819,983 M9L probably benign Het
Ldb3 T A 14: 34,529,461 *623L probably null Het
Lrrc27 A G 7: 139,218,307 D106G probably damaging Het
Ly6f A G 15: 75,271,728 N95D probably benign Het
Lyst A G 13: 13,669,927 I1901V probably benign Het
Mboat2 A G 12: 24,882,719 Y70C probably damaging Het
Mroh1 T A 15: 76,408,536 probably benign Het
Muc5b A G 7: 141,846,134 H448R unknown Het
Mut G A 17: 40,958,356 G610D probably damaging Het
Myh2 A G 11: 67,185,186 N733S probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nlrp1a A T 11: 71,123,665 I253N probably damaging Het
Ocrl A G X: 47,933,427 E258G probably benign Het
Olfr263 T A 13: 21,133,129 M118K probably damaging Het
Olfr791 A T 10: 129,527,143 R305S probably benign Het
Pak1 C A 7: 97,866,114 S115* probably null Het
Pilrb1 C T 5: 137,854,933 V203I possibly damaging Het
Ppfia2 T A 10: 106,906,395 Y1016* probably null Het
Prmt3 C A 7: 49,782,012 P121Q probably damaging Het
Rhox6 T A X: 37,827,630 I116N possibly damaging Het
Saxo2 A C 7: 82,643,741 F49L probably benign Het
Scn2a A C 2: 65,748,785 D1488A possibly damaging Het
Scn5a T A 9: 119,485,672 D1989V probably damaging Het
Sec31b C A 19: 44,518,185 E905* probably null Het
Secisbp2l A T 2: 125,750,286 F672I probably damaging Het
Slc22a23 C T 13: 34,183,075 G650E probably damaging Het
Smu1 A G 4: 40,748,658 F211L probably benign Het
Tab1 C T 15: 80,148,260 L23F probably benign Het
Thsd7b G A 1: 130,049,862 C1078Y probably benign Het
Ttn A T 2: 76,814,198 Y13071N probably damaging Het
Usp17ld A G 7: 103,250,663 V354A probably benign Het
Usp31 A G 7: 121,679,513 S210P probably damaging Het
Wdr12 T C 1: 60,087,062 D198G probably benign Het
Wrap53 A G 11: 69,563,318 V298A probably benign Het
Xirp2 A G 2: 67,510,147 I911V probably benign Het
Zcchc2 T C 1: 105,991,022 M78T unknown Het
Other mutations in Acta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Acta2 APN 19 34251791 missense probably damaging 0.98
IGL01802:Acta2 APN 19 34243436 missense possibly damaging 0.91
IGL01945:Acta2 APN 19 34251854 missense probably benign 0.03
IGL02136:Acta2 APN 19 34251830 missense probably damaging 1.00
IGL03114:Acta2 APN 19 34244910 critical splice donor site probably null
R0648:Acta2 UTSW 19 34248534 missense probably benign
R1393:Acta2 UTSW 19 34241792 missense probably damaging 1.00
R1597:Acta2 UTSW 19 34252583 splice site probably benign
R2045:Acta2 UTSW 19 34243399 missense probably damaging 1.00
R2338:Acta2 UTSW 19 34248541 splice site probably benign
R3940:Acta2 UTSW 19 34243480 missense possibly damaging 0.94
R3955:Acta2 UTSW 19 34251726 splice site probably benign
R4765:Acta2 UTSW 19 34246152 missense probably damaging 1.00
R4826:Acta2 UTSW 19 34251823 nonsense probably null
R6453:Acta2 UTSW 19 34246657 missense probably damaging 1.00
R6754:Acta2 UTSW 19 34244983 missense probably damaging 1.00
R6941:Acta2 UTSW 19 34252522 missense probably damaging 1.00
R7311:Acta2 UTSW 19 34241786 missense probably damaging 1.00
R7461:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7463:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7464:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7536:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7537:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7605:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7609:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7610:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7611:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7613:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7626:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7627:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7803:Acta2 UTSW 19 34243418 missense probably benign
R7872:Acta2 UTSW 19 34243439 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTCAGGGCCCATTTTAAGTG -3'
(R):5'- GCTTGAGTTTTACCCAGCATCC -3'

Sequencing Primer
(F):5'- GTGGTAGTGTTAAAATCTAACCCAC -3'
(R):5'- CAAGGATCACTGCCTGTGTC -3'
Posted On2015-02-05