Incidental Mutation 'R3114:March1'
ID 263930
Institutional Source Beutler Lab
Gene Symbol March1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane-associated ring finger (C3HC4) 1
Synonyms
MMRRC Submission 040587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R3114 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 65617900-66471637 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 66387381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 272 (H272P)
Ref Sequence ENSEMBL: ENSMUSP00000105885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
AlphaFold Q6NZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000039540
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072482
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098708
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110255
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110256
AA Change: H272P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: H272P

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110258
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110259
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably benign
Transcript: ENSMUST00000178982
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 C T 15: 102,534,423 S417N probably benign Het
Cdt1 C T 8: 122,570,482 Q305* probably null Het
Cfap65 T A 1: 74,927,132 K345N probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col11a2 T G 17: 34,046,468 V276G possibly damaging Het
Dnah8 A G 17: 30,833,568 S4346G probably benign Het
Dnhd1 T C 7: 105,696,565 probably null Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Fzd5 A G 1: 64,735,580 F341L probably benign Het
Gm1587 T G 14: 77,798,832 E11D unknown Het
Hist1h3c C A 13: 23,745,307 R64L probably benign Het
Ighv5-1 A G 12: 113,574,224 probably benign Het
Klhl3 A G 13: 58,051,027 probably null Het
Klhl33 A T 14: 50,891,515 D752E possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Mei1 C T 15: 82,124,959 A835V probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Mlxipl A G 5: 135,133,662 probably benign Het
Mob3a A T 10: 80,691,302 V63E probably damaging Het
Nos3 C T 5: 24,372,631 probably benign Het
Olfr1239 T A 2: 89,418,413 probably null Het
Pcdha11 T A 18: 37,011,807 I317K probably damaging Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Pds5a A G 5: 65,618,985 S89P probably damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rint1 A G 5: 23,819,420 N682S probably benign Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb8 A G 1: 107,607,293 I365V probably benign Het
Sik1 T C 17: 31,848,132 T505A probably benign Het
Slfn10-ps T A 11: 83,029,129 noncoding transcript Het
Sspn A T 6: 145,934,369 I66F possibly damaging Het
Tepp T C 8: 95,313,181 probably null Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tsc22d1 T C 14: 76,417,337 S337P probably damaging Het
Wdfy4 A G 14: 33,089,903 S1715P probably damaging Het
Other mutations in March1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:March1 APN 8 66418877 missense possibly damaging 0.88
IGL02468:March1 APN 8 66418911 missense probably damaging 1.00
R0391:March1 UTSW 8 66418973 missense probably damaging 1.00
R1500:March1 UTSW 8 66468390 missense probably damaging 1.00
R1794:March1 UTSW 8 66386942 missense possibly damaging 0.63
R2015:March1 UTSW 8 66121821 missense probably damaging 0.99
R2184:March1 UTSW 8 66387423 missense probably benign 0.07
R2273:March1 UTSW 8 66387499 missense probably benign 0.15
R2274:March1 UTSW 8 66387499 missense probably benign 0.15
R2275:March1 UTSW 8 66387499 missense probably benign 0.15
R2314:March1 UTSW 8 66121790 start codon destroyed probably null 0.77
R4458:March1 UTSW 8 66456171 missense probably damaging 1.00
R4656:March1 UTSW 8 66386419 missense probably benign 0.05
R4773:March1 UTSW 8 66387224 missense probably benign 0.03
R4838:March1 UTSW 8 66468363 missense probably damaging 1.00
R5073:March1 UTSW 8 66386368 missense probably benign 0.03
R5507:March1 UTSW 8 66418890 missense probably damaging 1.00
R5575:March1 UTSW 8 66468310 missense probably damaging 1.00
R5916:March1 UTSW 8 66387111 missense possibly damaging 0.89
R6931:March1 UTSW 8 66468492 missense probably benign 0.03
R7350:March1 UTSW 8 66468399 nonsense probably null
R7487:March1 UTSW 8 66456074 missense probably benign 0.14
R7531:March1 UTSW 8 66386337 missense probably benign
R7563:March1 UTSW 8 66468313 missense probably damaging 1.00
R7705:March1 UTSW 8 66468517 missense probably benign 0.00
R8142:March1 UTSW 8 66456126 missense probably benign 0.07
R8337:March1 UTSW 8 66418989 missense probably damaging 1.00
R8712:March1 UTSW 8 66468348 missense probably damaging 1.00
R9188:March1 UTSW 8 66456151 nonsense probably null
R9372:March1 UTSW 8 66468493 missense probably benign 0.01
R9477:March1 UTSW 8 66418890 missense probably damaging 1.00
R9790:March1 UTSW 8 66276687 missense probably benign 0.17
R9791:March1 UTSW 8 66276687 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTGATCTGGGATCCAAAGAGG -3'
(R):5'- GGTTGCGTCCAGTCTTTCAC -3'

Sequencing Primer
(F):5'- GAAAAGCACCAGGAGCTGAC -3'
(R):5'- TGACCTGCACACTTCGAAATTATCAG -3'
Posted On 2015-02-05