Incidental Mutation 'R3114:Krt24'
ID263938
Institutional Source Beutler Lab
Gene Symbol Krt24
Ensembl Gene ENSMUSG00000020913
Gene Namekeratin 24
Synonyms
MMRRC Submission 040587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R3114 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99279959-99285262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99282436 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 298 (T298S)
Ref Sequence ENSEMBL: ENSMUSP00000017255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017255
AA Change: T298S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017255
Gene: ENSMUSG00000020913
AA Change: T298S

DomainStartEndE-ValueType
Filament 140 456 5.23e-157 SMART
Meta Mutation Damage Score 0.1090 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 C T 15: 102,534,423 S417N probably benign Het
Cdt1 C T 8: 122,570,482 Q305* probably null Het
Cfap65 T A 1: 74,927,132 K345N probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col11a2 T G 17: 34,046,468 V276G possibly damaging Het
Dnah8 A G 17: 30,833,568 S4346G probably benign Het
Dnhd1 T C 7: 105,696,565 probably null Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Fzd5 A G 1: 64,735,580 F341L probably benign Het
Gm1587 T G 14: 77,798,832 E11D unknown Het
Hist1h3c C A 13: 23,745,307 R64L probably benign Het
Ighv5-1 A G 12: 113,574,224 probably benign Het
Klhl3 A G 13: 58,051,027 probably null Het
Klhl33 A T 14: 50,891,515 D752E possibly damaging Het
March1 A C 8: 66,387,381 H272P probably benign Het
Mei1 C T 15: 82,124,959 A835V probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Mlxipl A G 5: 135,133,662 probably benign Het
Mob3a A T 10: 80,691,302 V63E probably damaging Het
Nos3 C T 5: 24,372,631 probably benign Het
Olfr1239 T A 2: 89,418,413 probably null Het
Pcdha11 T A 18: 37,011,807 I317K probably damaging Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Pds5a A G 5: 65,618,985 S89P probably damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rint1 A G 5: 23,819,420 N682S probably benign Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb8 A G 1: 107,607,293 I365V probably benign Het
Sik1 T C 17: 31,848,132 T505A probably benign Het
Slfn10-ps T A 11: 83,029,129 noncoding transcript Het
Sspn A T 6: 145,934,369 I66F possibly damaging Het
Tepp T C 8: 95,313,181 probably null Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tsc22d1 T C 14: 76,417,337 S337P probably damaging Het
Wdfy4 A G 14: 33,089,903 S1715P probably damaging Het
Other mutations in Krt24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Krt24 APN 11 99285204 missense unknown
R0128:Krt24 UTSW 11 99280267 missense probably damaging 0.98
R0561:Krt24 UTSW 11 99284613 missense probably damaging 1.00
R1668:Krt24 UTSW 11 99284618 missense probably benign 0.16
R2018:Krt24 UTSW 11 99282451 missense probably damaging 1.00
R2307:Krt24 UTSW 11 99284630 missense possibly damaging 0.48
R3115:Krt24 UTSW 11 99282436 missense possibly damaging 0.85
R3116:Krt24 UTSW 11 99282436 missense possibly damaging 0.85
R3979:Krt24 UTSW 11 99282770 missense probably benign 0.23
R4805:Krt24 UTSW 11 99283626 missense possibly damaging 0.53
R5347:Krt24 UTSW 11 99282730 missense probably damaging 1.00
R5858:Krt24 UTSW 11 99284765 missense probably damaging 1.00
X0028:Krt24 UTSW 11 99281033 nonsense probably null
Z1176:Krt24 UTSW 11 99284886 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCAGGGATGCACTCTAAATG -3'
(R):5'- AGGCATTTTCCACCACATCC -3'

Sequencing Primer
(F):5'- ATAGAGCACAGTTAGTTGTCCTAGGC -3'
(R):5'- CAATGGTAACCAGTTCTCCTCCAGG -3'
Posted On2015-02-05