Mutagenetix > Incidental Mutations

Incidental Mutation 'R0324:Arap3'

26396

Institutional Source

Beutler Lab

Gene Symbol

Arap3

Ensembl Gene

ENSMUSG00000024451

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3

Synonyms

DRAG1, E030006K04Rik, Centd3

MMRRC Submission

038534-MU

Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene?

Possibly essential (E-score: 0.748) question?

Stock #

R0324 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37972624-37997574 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 37973225 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1522 (P1522S)

Ref Sequence

ENSEMBL: ENSMUSP00000035662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042944] [ENSMUST00000043437] [ENSMUST00000163131] [ENSMUST00000164222] [ENSMUST00000166148]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042944
AA Change: P1522S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: P1522S

Domain	Start	End	E-Value	Type
SAM	1	68	1.5e-7	SMART
low complexity region	81	98	N/A	INTRINSIC
low complexity region	134	142	N/A	INTRINSIC
PH	283	376	3.4e-16	SMART
PH	390	480	1.61e-8	SMART
ArfGap	484	606	1.44e-25	SMART
low complexity region	642	661	N/A	INTRINSIC
PH	671	785	2.86e1	SMART
PH	795	901	6.87e-3	SMART
RhoGAP	913	1089	2.11e-47	SMART
Pfam:RA	1113	1206	6.2e-16	PFAM
PH	1220	1323	3.46e-8	SMART
low complexity region	1388	1407	N/A	INTRINSIC
low complexity region	1457	1469	N/A	INTRINSIC
low complexity region	1475	1486	N/A	INTRINSIC
low complexity region	1494	1529	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000043437

SMART Domains

Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

Domain	Start	End	E-Value	Type
Pfam:FCH	21	100	1.6e-19	PFAM
coiled coil region	188	209	N/A	INTRINSIC
low complexity region	346	357	N/A	INTRINSIC
SH3	469	526	1.34e-8	SMART
SH3	547	606	1.94e-14	SMART
low complexity region	622	634	N/A	INTRINSIC
low complexity region	657	686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163131

SMART Domains

Protein: ENSMUSP00000133058
Gene: ENSMUSG00000038524

Domain	Start	End	E-Value	Type
Pfam:FCH	12	107	1.6e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164222

SMART Domains

Protein: ENSMUSP00000128481
Gene: ENSMUSG00000038524

Domain	Start	End	E-Value	Type
Pfam:FCH	12	56	2.5e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166148

SMART Domains

Protein: ENSMUSP00000129825
Gene: ENSMUSG00000038524

Domain	Start	End	E-Value	Type
Pfam:FCH	12	93	1.6e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171253

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184293

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.1%
20x: 93.1%

Validation Efficiency

MGI Phenotype

Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 9,001,157	L357S	probably benign	Het
1700129C05Rik	C	T	14: 59,142,807	R14H	probably damaging	Het
4933417A18Rik	A	G	13: 34,924,613	N26S	probably benign	Het
Aatf	A	G	11: 84,512,139		probably null	Het
Abca13	T	A	11: 9,297,669	M2472K	possibly damaging	Het
Abcd3	C	A	3: 121,769,167	Q540H	probably null	Het
Adam17	C	T	12: 21,349,938	V156I	probably benign	Het
Adam26a	A	G	8: 43,568,453	S667P	probably benign	Het
Adcy10	A	G	1: 165,564,249	K1333E	probably benign	Het
Apob	G	A	12: 8,010,521	R2968Q	probably benign	Het
Catsper1	A	T	19: 5,336,545	S269C	probably damaging	Het
Cd209d	A	T	8: 3,878,258	S42R	probably benign	Het
Cntln	T	A	4: 85,092,695	V1049E	probably damaging	Het
Cracr2b	T	C	7: 141,463,746	F87L	probably damaging	Het
Crb3	T	C	17: 57,065,133	L60P	probably damaging	Het
Crispld1	T	C	1: 17,749,591	V271A	probably benign	Het
Cyp2c66	G	T	19: 39,176,691	R372L	probably benign	Het
Ddx58	T	C	4: 40,213,766	T586A	probably benign	Het
Deup1	G	A	9: 15,582,533	R438W	probably benign	Het
Dnah6	C	T	6: 73,173,558	E741K	possibly damaging	Het
Epha4	T	C	1: 77,383,551	E703G	probably damaging	Het
Evc2	G	A	5: 37,393,099	R819H	probably damaging	Het
Fam217a	A	C	13: 34,910,961	C272G	possibly damaging	Het
Fndc7	T	C	3: 108,876,699		probably null	Het
Foxs1	C	T	2: 152,932,687	G149S	probably benign	Het
Galnt13	T	C	2: 54,854,616	V109A	probably benign	Het
Hmgxb4	G	A	8: 74,998,928	M7I	probably benign	Het
Klk1b1	T	A	7: 43,970,741	C209*	probably null	Het
Klra10	A	G	6: 130,272,650		probably null	Het
Kntc1	A	T	5: 123,778,112	K701N	probably damaging	Het
Lpgat1	T	A	1: 191,749,642	L114Q	probably damaging	Het
Mecom	T	A	3: 29,963,112	Q468L	probably damaging	Het
Med15	T	C	16: 17,697,612	T70A	probably damaging	Het
Msh6	T	A	17: 87,986,620	Y934*	probably null	Het
Mtus1	T	C	8: 41,084,395	T95A	probably benign	Het
Mylk3	C	A	8: 85,352,906	R444S	probably damaging	Het
Nbea	A	G	3: 56,057,948		probably null	Het
Nbeal1	T	C	1: 60,292,873	V2242A	probably damaging	Het
Nhp2	A	G	11: 51,622,507	T85A	possibly damaging	Het
Nlk	A	G	11: 78,572,431	S413P	possibly damaging	Het
Nmbr	A	G	10: 14,760,448	I54V	possibly damaging	Het
Nmur2	A	T	11: 56,040,520	C122S	probably damaging	Het
Nudt13	G	T	14: 20,311,515	V220L	probably damaging	Het
Olfr1025-ps1	G	A	2: 85,917,951	V9M	probably benign	Het
Pclo	G	A	5: 14,669,433	G1195R	unknown	Het
Pcsk7	A	G	9: 45,913,011	H276R	possibly damaging	Het
Pdss2	T	C	10: 43,393,928	S256P	probably damaging	Het
Pgf	G	T	12: 85,171,424	H116N	probably benign	Het
Pglyrp2	T	C	17: 32,418,328	D242G	probably benign	Het
Plk2	G	A	13: 110,397,708	R274K	probably benign	Het
Ppp6r3	G	T	19: 3,464,693	P141T	probably benign	Het
Prss54	T	C	8: 95,565,667	T95A	probably benign	Het
Rab3il1	A	G	19: 10,028,289	D149G	probably damaging	Het
Rasgef1c	T	C	11: 49,961,230		probably null	Het
Rhpn1	T	C	15: 75,711,588	M334T	probably damaging	Het
Robo2	C	T	16: 73,967,851	V630M	probably damaging	Het
Rptor	C	T	11: 119,892,641	R1154W	probably damaging	Het
Scnn1g	A	G	7: 121,740,555	I192M	possibly damaging	Het
Sit1	G	A	4: 43,482,815	Q115*	probably null	Het
Slc13a2	T	C	11: 78,404,524	N141S	probably damaging	Het
Slc19a2	C	A	1: 164,256,775	T78K	probably damaging	Het
Snx14	A	G	9: 88,405,238		probably null	Het
Stil	T	A	4: 115,039,149	C944S	probably benign	Het
Tnfaip2	A	G	12: 111,453,459	N675S	probably damaging	Het
Trim30c	A	G	7: 104,383,309	I270T	possibly damaging	Het
Ugt2a3	C	T	5: 87,327,073		probably null	Het
Vmn1r213	A	T	13: 23,011,418		probably benign	Het
Vmn2r8	A	C	5: 108,797,941		probably null	Het
Vps13c	T	C	9: 67,964,309	F3253L	possibly damaging	Het
Zbtb16	G	T	9: 48,665,275	Q502K	possibly damaging	Het
Zfp143	A	G	7: 110,077,147	K218E	possibly damaging	Het
Zfp946	A	G	17: 22,454,436	N57S	probably benign	Het
Zfp985	T	C	4: 147,582,857	Y61H	probably benign	Het
Zkscan1	G	A	5: 138,097,523	R246Q	probably damaging	Het
Zpld1	A	G	16: 55,251,615	F94L	probably damaging	Het
Zswim5	G	T	4: 116,986,906	W1047L	probably damaging	Het

Other mutations in Arap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Arap3	APN	18	37975926	missense	probably damaging	1.00
IGL01145:Arap3	APN	18	37989179	missense	probably benign
IGL01154:Arap3	APN	18	37996734	missense	probably benign	0.28
IGL01305:Arap3	APN	18	37991327	critical splice donor site	probably null
IGL01542:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01543:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01544:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01545:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01677:Arap3	APN	18	37996647	missense	probably benign
IGL01925:Arap3	APN	18	37984246	missense	probably benign	0.21
IGL01933:Arap3	APN	18	37978453	missense	possibly damaging	0.65
IGL02048:Arap3	APN	18	37996979	missense	possibly damaging	0.56
IGL02064:Arap3	APN	18	37991701	missense	probably damaging	1.00
IGL02207:Arap3	APN	18	37987853	missense	probably benign	0.00
IGL02376:Arap3	APN	18	37978453	missense	possibly damaging	0.95
IGL02531:Arap3	APN	18	37989751	missense	probably damaging	0.99
IGL02568:Arap3	APN	18	37996658	missense	probably benign	0.32
IGL02640:Arap3	APN	18	37987802	missense	possibly damaging	0.71
IGL02658:Arap3	APN	18	37990994	missense	probably benign	0.09
IGL03090:Arap3	APN	18	37989112	missense	probably benign	0.00
IGL03352:Arap3	APN	18	37981302	splice site	probably benign
ANU22:Arap3	UTSW	18	37991327	critical splice donor site	probably null
P0016:Arap3	UTSW	18	37984348	missense	probably benign	0.00
PIT4260001:Arap3	UTSW	18	37996895	missense	probably benign	0.08
R0066:Arap3	UTSW	18	37996707	missense	probably benign	0.01
R0562:Arap3	UTSW	18	37975540	missense	probably damaging	1.00
R1289:Arap3	UTSW	18	37981973	missense	possibly damaging	0.95
R1346:Arap3	UTSW	18	37975918	missense	probably damaging	1.00
R1419:Arap3	UTSW	18	37978432	missense	possibly damaging	0.51
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1537:Arap3	UTSW	18	37989684	critical splice donor site	probably null
R1644:Arap3	UTSW	18	37984245	missense	probably damaging	1.00
R1731:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1758:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1843:Arap3	UTSW	18	37975583	missense	probably damaging	1.00
R1907:Arap3	UTSW	18	37996671	missense	probably benign	0.28
R1954:Arap3	UTSW	18	37982002	missense	probably damaging	1.00
R2124:Arap3	UTSW	18	37973350	missense	probably damaging	0.98
R2135:Arap3	UTSW	18	37974456	missense	probably damaging	1.00
R2172:Arap3	UTSW	18	37990560	missense	probably damaging	1.00
R2418:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2419:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2907:Arap3	UTSW	18	37990527	missense	possibly damaging	0.88
R4425:Arap3	UTSW	18	37978600	missense	probably damaging	1.00
R4669:Arap3	UTSW	18	37996254	missense	probably benign	0.08
R4734:Arap3	UTSW	18	37996275	missense	probably benign	0.00
R4815:Arap3	UTSW	18	37973243	missense	probably benign
R5328:Arap3	UTSW	18	37991687	missense	possibly damaging	0.92
R5350:Arap3	UTSW	18	37982035	missense	probably damaging	1.00
R5466:Arap3	UTSW	18	37996736	missense	probably benign	0.00
R5482:Arap3	UTSW	18	37974674	missense	possibly damaging	0.95
R5572:Arap3	UTSW	18	37991066	missense	probably damaging	1.00
R5779:Arap3	UTSW	18	37984365	missense	probably damaging	1.00
R6053:Arap3	UTSW	18	37990771	missense	probably damaging	0.98
R6144:Arap3	UTSW	18	37985433	missense	probably damaging	0.98
R6166:Arap3	UTSW	18	37974370	missense	probably damaging	1.00
R6248:Arap3	UTSW	18	37991354	missense	probably benign	0.09
R6266:Arap3	UTSW	18	37990791	missense	probably damaging	0.98
R6385:Arap3	UTSW	18	37997031	nonsense	probably null
R6694:Arap3	UTSW	18	37991537	critical splice donor site	probably null
R6856:Arap3	UTSW	18	37979863	missense	possibly damaging	0.95
R7073:Arap3	UTSW	18	37974442	nonsense	probably null
R7297:Arap3	UTSW	18	37973563	missense	possibly damaging	0.81
R7352:Arap3	UTSW	18	37973278	missense	probably benign	0.00
R7652:Arap3	UTSW	18	37978452	missense	probably damaging	0.99
R7726:Arap3	UTSW	18	37989467	missense	probably damaging	0.99
R7747:Arap3	UTSW	18	37988888	splice site	probably null
R7944:Arap3	UTSW	18	37989179	missense	probably benign
R8152:Arap3	UTSW	18	37991357	missense	possibly damaging	0.61
R8338:Arap3	UTSW	18	37973630	missense	probably damaging	0.99
R8549:Arap3	UTSW	18	37973312	missense	probably benign	0.17
X0011:Arap3	UTSW	18	37974101	critical splice donor site	probably null
X0026:Arap3	UTSW	18	37985311	critical splice donor site	probably null
X0027:Arap3	UTSW	18	37973485	splice site	probably null
X0066:Arap3	UTSW	18	37991646	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGTCATCCATCCAGGGCAGAAG -3'
(R):5'- GTGGTCAGCCAAGTCAGATCCATC -3'

Sequencing Primer
(F):5'- GCAGCTCCCAGCAGTAATC -3'
(R):5'- GAGAGGATACCTGACCCTCC -3'

Posted On

2013-04-16