Mutagenetix > Incidental Mutation

Incidental Mutation 'R3115:Cnot1'

263981

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040588-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3115 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95744278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1314 (E1314G)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: E1309G

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: E1309G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083155

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098473
AA Change: E1314G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: E1314G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: E1307G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

unknown
Transcript: ENSMUST00000211973
AA Change: E781G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213006
AA Change: E1314G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.0612

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	A	G	8: 86,540,024		probably null	Het
Abcc9	T	C	6: 142,689,029	T170A	probably benign	Het
Agbl2	T	C	2: 90,805,901	S594P	possibly damaging	Het
Atf7	C	T	15: 102,534,423	S417N	probably benign	Het
C130026I21Rik	C	G	1: 85,257,385		probably benign	Het
Cacng7	T	C	7: 3,338,934	V111A	probably benign	Het
Chrm4	A	G	2: 91,927,360	T38A	probably benign	Het
Dcx	A	G	X: 143,923,109	Y229H	probably damaging	Het
Espl1	T	A	15: 102,323,204	F1945Y	possibly damaging	Het
Glul	T	C	1: 153,907,292	F204L	possibly damaging	Het
Gm597	A	C	1: 28,776,329	V874G	possibly damaging	Het
Grm2	A	G	9: 106,647,623	V631A	probably damaging	Het
Ifi205	T	A	1: 174,028,335	Y43F	possibly damaging	Het
Irs3	A	G	5: 137,643,856	L440P	probably benign	Het
Itpr1	A	G	6: 108,406,109	D1466G	possibly damaging	Het
Jarid2	T	C	13: 44,896,466	S257P	probably damaging	Het
Knl1	C	A	2: 119,070,391	L858M	possibly damaging	Het
Krt24	T	A	11: 99,282,436	T298S	possibly damaging	Het
Lrriq1	C	T	10: 103,170,433	R1277Q	probably benign	Het
Mgp	A	C	6: 136,872,685	Y92D	probably damaging	Het
Micu3	A	G	8: 40,382,167	H521R	probably benign	Het
Mier3	T	A	13: 111,706,648	I178N	probably damaging	Het
Moxd1	G	T	10: 24,301,531	E582*	probably null	Het
Mprip	T	A	11: 59,765,403		probably null	Het
Mybph	A	G	1: 134,194,738	I174V	probably benign	Het
Mynn	C	T	3: 30,607,810	T347M	probably damaging	Het
Nhsl1	A	T	10: 18,525,168	Q714L	probably damaging	Het
Nr1d2	A	T	14: 18,215,504		probably null	Het
Olfr1512	T	C	14: 52,372,940	T38A	probably damaging	Het
Olfr448	T	C	6: 42,896,850	V133A	probably benign	Het
Olfr485	T	C	7: 108,159,822	E17G	probably benign	Het
Olfr651	C	A	7: 104,553,088	H56Q	probably benign	Het
Pcdha4	T	C	18: 36,953,550	V262A	probably benign	Het
Pde4d	T	A	13: 109,948,258	M519K	probably damaging	Het
Phactr2	C	A	10: 13,261,901	E166*	probably null	Het
Prdx4	C	T	X: 155,330,411	R167Q	probably damaging	Het
Prkdc	C	T	16: 15,664,358	L422F	probably benign	Het
Prph	T	A	15: 99,055,456	F84I	probably damaging	Het
Rnmt	A	G	18: 68,314,008	E321G	probably benign	Het
Serpinb13	A	T	1: 106,982,838	E64V	probably null	Het
Slc12a4	A	T	8: 105,959,459	S81T	probably damaging	Het
Slc47a1	A	G	11: 61,367,680	L179P	possibly damaging	Het
Svs1	A	G	6: 48,987,397	Y113C	probably damaging	Het
Sycp2l	C	A	13: 41,148,798	T456K	probably benign	Het
Tenm2	A	G	11: 36,023,366	L2447P	probably damaging	Het
Tll1	A	G	8: 64,053,866	C614R	probably damaging	Het
Usp5	T	C	6: 124,815,597	Y826C	probably damaging	Het
Vmn2r71	A	C	7: 85,623,658	D560A	probably damaging	Het
Wdr91	A	G	6: 34,905,587	L209P	probably damaging	Het
Zfp511	T	A	7: 140,036,591	D46E	probably benign	Het
Zfp81	C	T	17: 33,334,563	A426T	possibly damaging	Het
Zscan22	T	C	7: 12,907,290	I328T	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TCTAGTAAGCCTATCCTTAGATGCTG -3'
(R):5'- CAGTGGTCATTGCACCAGTG -3'

Sequencing Primer
(F):5'- GCTCACACTTGATAATCAGATGGCTC -3'
(R):5'- CATTGCACCAGTGGATTGAATTG -3'

Posted On

2015-02-05