Incidental Mutation 'R3115:Pde4d'
ID263993
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3115 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109948258 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 519 (M519K)
Ref Sequence ENSEMBL: ENSMUSP00000112991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074103] [ENSMUST00000079975] [ENSMUST00000117420] [ENSMUST00000117879] [ENSMUST00000119507] [ENSMUST00000119672] [ENSMUST00000120664] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074103
AA Change: M394K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073742
Gene: ENSMUSG00000021699
AA Change: M394K

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
HDc 329 504 1.12e-2 SMART
low complexity region 652 667 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079975
AA Change: M414K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699
AA Change: M414K

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117420
AA Change: M233K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113610
Gene: ENSMUSG00000021699
AA Change: M233K

DomainStartEndE-ValueType
HDc 168 343 1.12e-2 SMART
low complexity region 491 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117879
AA Change: M220K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112774
Gene: ENSMUSG00000021699
AA Change: M220K

DomainStartEndE-ValueType
HDc 155 330 1.12e-2 SMART
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119507
AA Change: M419K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699
AA Change: M419K

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119672
Predicted Effect probably damaging
Transcript: ENSMUST00000120664
AA Change: M300K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113024
Gene: ENSMUSG00000021699
AA Change: M300K

DomainStartEndE-ValueType
HDc 235 410 1.12e-2 SMART
low complexity region 558 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120671
AA Change: M519K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699
AA Change: M519K

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122041
AA Change: M463K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: M463K

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135275
AA Change: M416K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: M416K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153234
AA Change: M469K
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699
AA Change: M469K

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155459
SMART Domains Protein: ENSMUSP00000114945
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
Pfam:PDEase_I 121 189 2.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177907
AA Change: M463K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: M463K

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Meta Mutation Damage Score 0.8842 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
R7164:Pde4d UTSW 13 109032688 missense probably benign
R7222:Pde4d UTSW 13 109757579 missense probably damaging 1.00
R7417:Pde4d UTSW 13 109632788 synonymous probably null
R7489:Pde4d UTSW 13 109116767 missense unknown
R7563:Pde4d UTSW 13 109951007 missense probably benign 0.37
R7861:Pde4d UTSW 13 109935324 missense probably damaging 0.99
R7944:Pde4d UTSW 13 109935324 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAAGCATCCTAGAACTTGGGG -3'
(R):5'- TTACAAAAGGAGCCTGCTGG -3'

Sequencing Primer
(F):5'- AGCATCCTAGAACTTGGGGGTTTG -3'
(R):5'- GGAGCAACTTAAAGCCCA -3'
Posted On2015-02-05