Incidental Mutation 'R3115:Nr1d2'
ID263995
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Namenuclear receptor subfamily 1, group D, member 2
SynonymsRev-erb beta, RVR
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3115 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location18204054-18239127 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 18215504 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543] [ENSMUST00000225491]
PDB Structure
[]
Predicted Effect probably null
Transcript: ENSMUST00000090543
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225308
Predicted Effect probably benign
Transcript: ENSMUST00000225491
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18215502 intron probably benign
IGL00897:Nr1d2 APN 14 18214993 missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18222011 missense probably benign
IGL03039:Nr1d2 APN 14 18215184 missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18216703 missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18215403 missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18215502 intron probably benign
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18215086 missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18211891 missense probably benign 0.04
R3738:Nr1d2 UTSW 14 18211804 missense possibly damaging 0.74
R4165:Nr1d2 UTSW 14 18215446 missense probably benign 0.05
R5319:Nr1d2 UTSW 14 18215197 missense probably benign 0.00
R5353:Nr1d2 UTSW 14 18222125 missense probably benign 0.05
R5384:Nr1d2 UTSW 14 18211922 missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18206860 missense possibly damaging 0.65
R5827:Nr1d2 UTSW 14 18222248 missense possibly damaging 0.88
R7873:Nr1d2 UTSW 14 18216656 nonsense probably null
R8268:Nr1d2 UTSW 14 18216659 missense probably damaging 1.00
X0067:Nr1d2 UTSW 14 18211823 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGCTGTTCCTGAGCTGGTAG -3'
(R):5'- TTGCCCGGCTTTAGTAAGGG -3'

Sequencing Primer
(F):5'- CCTGAGCTGGTAGTGCTGAC -3'
(R):5'- AAAAACTCAACGTCTTTTTCTTACCC -3'
Posted On2015-02-05