Incidental Mutation 'R3115:Prph'
ID263997
Institutional Source Beutler Lab
Gene Symbol Prph
Ensembl Gene ENSMUSG00000023484
Gene Nameperipherin
SynonymsPrph1
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R3115 (G1)
Quality Score218
Status Validated
Chromosome15
Chromosomal Location99055174-99058978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99055456 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 84 (F84I)
Ref Sequence ENSEMBL: ENSMUSP00000155294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024249] [ENSMUST00000047104] [ENSMUST00000229268] [ENSMUST00000230021]
Predicted Effect probably damaging
Transcript: ENSMUST00000024249
AA Change: F84I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024249
Gene: ENSMUSG00000023484
AA Change: F84I

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 2.7e-18 PFAM
Pfam:Filament 100 410 4.5e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047104
AA Change: F84I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049303
Gene: ENSMUSG00000023484
AA Change: F84I

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 3.2e-18 PFAM
Filament 100 442 1.87e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229268
Predicted Effect probably damaging
Transcript: ENSMUST00000230021
AA Change: F84I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3461 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin, and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice showed no overt phenotype up to 14 months of age. While overall structure, number, and caliber of large myelinated axons was normal, mice had reduced numbers of a small subset of unmelinated sensory axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Prph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Prph APN 15 99058636 missense possibly damaging 0.88
IGL01472:Prph APN 15 99058593 splice site probably benign
IGL01868:Prph APN 15 99056343 missense probably damaging 1.00
IGL02714:Prph APN 15 99056866 missense probably damaging 1.00
IGL02816:Prph APN 15 99057420 missense probably damaging 0.97
R0242:Prph UTSW 15 99055727 missense probably damaging 1.00
R0396:Prph UTSW 15 99056991 missense probably benign
R0441:Prph UTSW 15 99057438 missense probably damaging 1.00
R2065:Prph UTSW 15 99056133 missense probably damaging 1.00
R2326:Prph UTSW 15 99055282 unclassified probably benign
R4441:Prph UTSW 15 99057124 missense probably damaging 1.00
R4794:Prph UTSW 15 99057427 missense probably damaging 1.00
R5058:Prph UTSW 15 99055232 unclassified probably benign
R5463:Prph UTSW 15 99055400 missense probably benign 0.43
R6199:Prph UTSW 15 99056832 missense probably benign 0.33
R6242:Prph UTSW 15 99057123 missense probably damaging 0.99
R6502:Prph UTSW 15 99056386 missense probably damaging 1.00
R7356:Prph UTSW 15 99056926 missense probably damaging 1.00
R7818:Prph UTSW 15 99057872 missense probably damaging 1.00
R8353:Prph UTSW 15 99056776 missense probably benign 0.02
Z1177:Prph UTSW 15 99056380 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCCATCATCACTCGTCG -3'
(R):5'- ATGTCTGGTCACTTCCGCTAG -3'

Sequencing Primer
(F):5'- ATCATCACTCGTCGGGCCTG -3'
(R):5'- TGACCTCTGCTTGAGCGC -3'
Posted On2015-02-05