Incidental Mutation 'R3115:Espl1'
ID 263998
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 040588-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3115 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102231639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1945 (F1945Y)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably benign
Transcript: ENSMUST00000001335
SMART Domains Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
SCOP:d1fxkc_ 12 58 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062492
SMART Domains Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000064924
AA Change: F1945Y

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: F1945Y

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165671
SMART Domains Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165717
SMART Domains Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 72 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166658
SMART Domains Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 22 143 8.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168805
Predicted Effect probably benign
Transcript: ENSMUST00000169637
SMART Domains Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 58 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170627
SMART Domains Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 7 99 4.6e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000229942
AA Change: F79Y
Predicted Effect possibly damaging
Transcript: ENSMUST00000229050
AA Change: F1945Y

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231207
Meta Mutation Damage Score 0.4196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 87,266,653 (GRCm39) probably null Het
Abcc9 T C 6: 142,634,755 (GRCm39) T170A probably benign Het
Agbl2 T C 2: 90,636,245 (GRCm39) S594P possibly damaging Het
Aoc1l3 A G 6: 48,964,331 (GRCm39) Y113C probably damaging Het
Atf7 C T 15: 102,442,858 (GRCm39) S417N probably benign Het
Cacng7 T C 7: 3,387,450 (GRCm39) V111A probably benign Het
Chrm4 A G 2: 91,757,705 (GRCm39) T38A probably benign Het
Cnot1 T C 8: 96,470,906 (GRCm39) E1314G possibly damaging Het
Dcx A G X: 142,706,105 (GRCm39) Y229H probably damaging Het
Glul T C 1: 153,783,038 (GRCm39) F204L possibly damaging Het
Grm2 A G 9: 106,524,822 (GRCm39) V631A probably damaging Het
Ifi205 T A 1: 173,855,901 (GRCm39) Y43F possibly damaging Het
Irs3 A G 5: 137,642,118 (GRCm39) L440P probably benign Het
Itpr1 A G 6: 108,383,070 (GRCm39) D1466G possibly damaging Het
Jarid2 T C 13: 45,049,942 (GRCm39) S257P probably damaging Het
Knl1 C A 2: 118,900,872 (GRCm39) L858M possibly damaging Het
Krt24 T A 11: 99,173,262 (GRCm39) T298S possibly damaging Het
Lrriq1 C T 10: 103,006,294 (GRCm39) R1277Q probably benign Het
Mgp A C 6: 136,849,683 (GRCm39) Y92D probably damaging Het
Micu3 A G 8: 40,835,208 (GRCm39) H521R probably benign Het
Mier3 T A 13: 111,843,182 (GRCm39) I178N probably damaging Het
Moxd1 G T 10: 24,177,429 (GRCm39) E582* probably null Het
Mprip T A 11: 59,656,229 (GRCm39) probably null Het
Mybph A G 1: 134,122,476 (GRCm39) I174V probably benign Het
Mynn C T 3: 30,661,959 (GRCm39) T347M probably damaging Het
Nhsl1 A T 10: 18,400,916 (GRCm39) Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 (GRCm38) probably null Het
Or10g3 T C 14: 52,610,397 (GRCm39) T38A probably damaging Het
Or2a5 T C 6: 42,873,784 (GRCm39) V133A probably benign Het
Or52h9 C A 7: 104,202,295 (GRCm39) H56Q probably benign Het
Or5p61 T C 7: 107,759,029 (GRCm39) E17G probably benign Het
Pcdha4 T C 18: 37,086,603 (GRCm39) V262A probably benign Het
Pde4d T A 13: 110,084,792 (GRCm39) M519K probably damaging Het
Phactr2 C A 10: 13,137,645 (GRCm39) E166* probably null Het
Prdx4 C T X: 154,113,407 (GRCm39) R167Q probably damaging Het
Prkdc C T 16: 15,482,222 (GRCm39) L422F probably benign Het
Prph T A 15: 98,953,337 (GRCm39) F84I probably damaging Het
Rnmt A G 18: 68,447,079 (GRCm39) E321G probably benign Het
Serpinb13 A T 1: 106,910,568 (GRCm39) E64V probably null Het
Slc12a4 A T 8: 106,686,091 (GRCm39) S81T probably damaging Het
Slc47a1 A G 11: 61,258,506 (GRCm39) L179P possibly damaging Het
Sp140l2 C G 1: 85,235,106 (GRCm39) probably benign Het
Spata31e5 A C 1: 28,815,410 (GRCm39) V874G possibly damaging Het
Sycp2l C A 13: 41,302,274 (GRCm39) T456K probably benign Het
Tenm2 A G 11: 35,914,193 (GRCm39) L2447P probably damaging Het
Tll1 A G 8: 64,506,900 (GRCm39) C614R probably damaging Het
Usp5 T C 6: 124,792,560 (GRCm39) Y826C probably damaging Het
Vmn2r71 A C 7: 85,272,866 (GRCm39) D560A probably damaging Het
Wdr91 A G 6: 34,882,522 (GRCm39) L209P probably damaging Het
Zfp511 T A 7: 139,616,504 (GRCm39) D46E probably benign Het
Zfp81 C T 17: 33,553,537 (GRCm39) A426T possibly damaging Het
Zscan22 T C 7: 12,641,217 (GRCm39) I328T probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCACTAAAGAGGTGGGC -3'
(R):5'- AAGCAGCCACTGATTCTGGAG -3'

Sequencing Primer
(F):5'- ACTGGCTGTTGGGTAAAGCCTAAG -3'
(R):5'- CTGATTCTGGAGCAAAAGCACTCATG -3'
Posted On 2015-02-05