Incidental Mutation 'R3116:Slc12a5'
ID264007
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Namesolute carrier family 12, member 5
SynonymsKCC2
MMRRC Submission 040589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3116 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164960802-164999731 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 164996181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040381] [ENSMUST00000099092] [ENSMUST00000121377] [ENSMUST00000122070] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
Predicted Effect probably benign
Transcript: ENSMUST00000040381
SMART Domains Protein: ENSMUSP00000046388
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 2e-9 SMART
PDB:1V95|A 197 314 3e-79 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 395 427 N/A INTRINSIC
low complexity region 440 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099092
AA Change: N954K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: N954K

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121377
SMART Domains Protein: ENSMUSP00000113872
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
PDB:1V95|A 1 34 2e-15 PDB
low complexity region 44 60 N/A INTRINSIC
low complexity region 87 96 N/A INTRINSIC
low complexity region 115 147 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122070
SMART Domains Protein: ENSMUSP00000113166
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 1e-8 SMART
PDB:1V95|A 197 314 2e-80 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137302
Predicted Effect probably benign
Transcript: ENSMUST00000202223
AA Change: N977K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: N977K

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202479
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202623
AA Change: N977K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: N977K

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,896,610 I37F possibly damaging Het
Ccdc146 T C 5: 21,316,955 N357S probably benign Het
Csmd3 A G 15: 47,657,599 F2783S probably damaging Het
Desi2 T A 1: 178,244,442 M104K probably damaging Het
Disp1 C T 1: 183,088,922 V645I probably benign Het
Dock8 A T 19: 25,188,494 H1914L probably benign Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Ffar3 T C 7: 30,855,806 M30V probably benign Het
Grm3 A T 5: 9,570,752 F164Y probably damaging Het
Ints5 T C 19: 8,894,772 S32P possibly damaging Het
Itgam T A 7: 128,116,029 S908R probably damaging Het
Kif20b C T 19: 34,970,080 P1565L probably benign Het
Kntc1 A G 5: 123,802,058 E1610G probably damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
March6 G A 15: 31,486,119 S362F probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Ncor2 A T 5: 125,024,166 L2195Q probably damaging Het
Neil1 A T 9: 57,146,663 D124E probably benign Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nipbl T A 15: 8,343,592 M1057L probably benign Het
Npas3 G A 12: 54,067,725 probably null Het
Oas1h C T 5: 120,861,616 Q55* probably null Het
Olfr39 A T 9: 20,286,227 H176L probably benign Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Olfr701 T A 7: 106,818,364 F94I probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Pum1 T C 4: 130,772,660 V1051A probably damaging Het
Pxdn T C 12: 30,002,307 S828P possibly damaging Het
Rad21 T A 15: 51,965,001 E557V probably null Het
Rtn3 T G 19: 7,431,990 N888H probably damaging Het
Slc7a11 T A 3: 50,384,139 M274L probably benign Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Tacc2 A G 7: 130,759,249 N825S probably damaging Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tln2 T A 9: 67,355,139 D610V probably benign Het
Tmed11 C T 5: 108,779,839 V110M probably damaging Het
Tmem92 T C 11: 94,782,428 D3G possibly damaging Het
Trp53rkb C T 2: 166,794,089 probably benign Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp804a C A 2: 82,259,417 Q1197K probably damaging Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164997121 missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164983281 missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164979304 missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164973755 missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164990381 missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164996479 missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164982808 splice site probably benign
IGL02746:Slc12a5 APN 2 164974916 missense probably benign 0.01
R0051:Slc12a5 UTSW 2 164986663 missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164997245 critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164994062 missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164976533 missense probably damaging 1.00
R0835:Slc12a5 UTSW 2 164994038 missense probably damaging 0.97
R0932:Slc12a5 UTSW 2 164996885 splice site probably benign
R1643:Slc12a5 UTSW 2 164994027 missense probably benign 0.01
R1700:Slc12a5 UTSW 2 164992376 missense possibly damaging 0.94
R1760:Slc12a5 UTSW 2 164996128 missense probably damaging 0.99
R2063:Slc12a5 UTSW 2 164997147 missense probably damaging 1.00
R2293:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164976462 critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164980258 missense probably benign 0.06
R3412:Slc12a5 UTSW 2 164968431 missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164993775 missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164979490 missense probably damaging 1.00
R4492:Slc12a5 UTSW 2 164979343 missense probably benign 0.08
R4608:Slc12a5 UTSW 2 164973765 missense probably damaging 0.99
R4750:Slc12a5 UTSW 2 164982931 missense probably benign 0.06
R4994:Slc12a5 UTSW 2 164983365 splice site probably null
R5103:Slc12a5 UTSW 2 164992433 missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164987206 missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164987221 missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164973768 missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164992311 missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164992464 splice site probably null
R6581:Slc12a5 UTSW 2 164987115 missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164988589 missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164982905 missense probably benign
R7134:Slc12a5 UTSW 2 164974958 missense probably damaging 1.00
R7310:Slc12a5 UTSW 2 164992440 missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164982932 missense probably benign 0.01
R8079:Slc12a5 UTSW 2 164992452 missense probably damaging 1.00
R8301:Slc12a5 UTSW 2 164993691 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTAACCCGGATAAGCATCC -3'
(R):5'- GTAAGATGCACCTCTGGGTC -3'

Sequencing Primer
(F):5'- AGCATCCACTGTAGTAATGGCTC -3'
(R):5'- CTGGAGATGGCGAGCTGCTAG -3'
Posted On2015-02-05