Incidental Mutation 'R3116:Grm3'
ID 264012
Institutional Source Beutler Lab
Gene Symbol Grm3
Ensembl Gene ENSMUSG00000003974
Gene Name glutamate receptor, metabotropic 3
Synonyms Gprc1c, mGlu3, mGluR3, 0710001G23Rik
MMRRC Submission 040589-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3116 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 9485541-9725170 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9570752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 164 (F164Y)
Ref Sequence ENSEMBL: ENSMUSP00000004076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004076]
AlphaFold Q9QYS2
Predicted Effect probably damaging
Transcript: ENSMUST00000004076
AA Change: F164Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: F164Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 67 473 4.8e-102 PFAM
Pfam:NCD3G 505 555 2.4e-14 PFAM
Pfam:7tm_3 588 825 4.7e-62 PFAM
low complexity region 849 861 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,896,610 I37F possibly damaging Het
Ccdc146 T C 5: 21,316,955 N357S probably benign Het
Csmd3 A G 15: 47,657,599 F2783S probably damaging Het
Desi2 T A 1: 178,244,442 M104K probably damaging Het
Disp1 C T 1: 183,088,922 V645I probably benign Het
Dock8 A T 19: 25,188,494 H1914L probably benign Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Ffar3 T C 7: 30,855,806 M30V probably benign Het
Ints5 T C 19: 8,894,772 S32P possibly damaging Het
Itgam T A 7: 128,116,029 S908R probably damaging Het
Kif20b C T 19: 34,970,080 P1565L probably benign Het
Kntc1 A G 5: 123,802,058 E1610G probably damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
March6 G A 15: 31,486,119 S362F probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Ncor2 A T 5: 125,024,166 L2195Q probably damaging Het
Neil1 A T 9: 57,146,663 D124E probably benign Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nipbl T A 15: 8,343,592 M1057L probably benign Het
Npas3 G A 12: 54,067,725 probably null Het
Oas1h C T 5: 120,861,616 Q55* probably null Het
Olfr39 A T 9: 20,286,227 H176L probably benign Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Olfr701 T A 7: 106,818,364 F94I probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Pum1 T C 4: 130,772,660 V1051A probably damaging Het
Pxdn T C 12: 30,002,307 S828P possibly damaging Het
Rad21 T A 15: 51,965,001 E557V probably null Het
Rtn3 T G 19: 7,431,990 N888H probably damaging Het
Slc12a5 T A 2: 164,996,181 probably null Het
Slc7a11 T A 3: 50,384,139 M274L probably benign Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Tacc2 A G 7: 130,759,249 N825S probably damaging Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tln2 T A 9: 67,355,139 D610V probably benign Het
Tmed11 C T 5: 108,779,839 V110M probably damaging Het
Tmem92 T C 11: 94,782,428 D3G possibly damaging Het
Trp53rkb C T 2: 166,794,089 probably benign Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp804a C A 2: 82,259,417 Q1197K probably damaging Het
Other mutations in Grm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Grm3 APN 5 9512290 missense probably benign
IGL01393:Grm3 APN 5 9589856 missense probably benign 0.00
IGL01398:Grm3 APN 5 9485762 unclassified probably benign
IGL01825:Grm3 APN 5 9511600 missense probably damaging 1.00
IGL01966:Grm3 APN 5 9511486 missense probably damaging 0.98
IGL02367:Grm3 APN 5 9511660 missense probably damaging 1.00
IGL02526:Grm3 APN 5 9589847 missense probably damaging 1.00
IGL02972:Grm3 APN 5 9512410 missense probably damaging 1.00
IGL03356:Grm3 APN 5 9512206 missense possibly damaging 0.89
BB002:Grm3 UTSW 5 9589880 missense probably benign 0.09
BB012:Grm3 UTSW 5 9589880 missense probably benign 0.09
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0389:Grm3 UTSW 5 9504794 missense probably damaging 1.00
R0455:Grm3 UTSW 5 9512477 missense probably benign
R0538:Grm3 UTSW 5 9512446 missense possibly damaging 0.95
R0553:Grm3 UTSW 5 9570048 missense probably benign 0.16
R1124:Grm3 UTSW 5 9570297 missense probably benign
R1163:Grm3 UTSW 5 9570738 missense probably benign 0.34
R1440:Grm3 UTSW 5 9589958 missense probably benign
R1635:Grm3 UTSW 5 9511520 missense probably damaging 1.00
R1734:Grm3 UTSW 5 9589742 missense probably benign 0.00
R1895:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R1926:Grm3 UTSW 5 9504881 missense probably damaging 0.98
R1940:Grm3 UTSW 5 9511682 missense probably damaging 1.00
R1946:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R2004:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2005:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2006:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R4083:Grm3 UTSW 5 9512054 missense probably benign
R4537:Grm3 UTSW 5 9512083 missense probably benign 0.02
R4855:Grm3 UTSW 5 9570047 missense probably damaging 0.98
R5060:Grm3 UTSW 5 9570167 missense probably damaging 0.99
R5093:Grm3 UTSW 5 9589766 missense probably benign 0.01
R5419:Grm3 UTSW 5 9570233 missense probably damaging 1.00
R5525:Grm3 UTSW 5 9504872 missense probably damaging 1.00
R5642:Grm3 UTSW 5 9570536 missense probably benign 0.21
R5804:Grm3 UTSW 5 9570155 missense probably benign 0.33
R5915:Grm3 UTSW 5 9511927 missense probably damaging 1.00
R5966:Grm3 UTSW 5 9511930 missense probably damaging 0.98
R6151:Grm3 UTSW 5 9511556 missense probably damaging 1.00
R6419:Grm3 UTSW 5 9570201 missense probably damaging 1.00
R7267:Grm3 UTSW 5 9589581 missense probably benign 0.00
R7555:Grm3 UTSW 5 9570000 missense probably benign 0.00
R7657:Grm3 UTSW 5 9511452 splice site probably null
R7925:Grm3 UTSW 5 9589880 missense probably benign 0.09
R8032:Grm3 UTSW 5 9512272 missense probably benign 0.11
R8227:Grm3 UTSW 5 9570242 missense possibly damaging 0.65
R8462:Grm3 UTSW 5 9512365 missense probably benign
R8500:Grm3 UTSW 5 9511726 missense probably benign 0.21
R8696:Grm3 UTSW 5 9512311 missense probably damaging 1.00
R8807:Grm3 UTSW 5 9511499 missense probably damaging 1.00
R8828:Grm3 UTSW 5 9504725 missense probably benign 0.00
R8876:Grm3 UTSW 5 9511580 missense probably damaging 1.00
R8896:Grm3 UTSW 5 9512483 missense possibly damaging 0.91
R9035:Grm3 UTSW 5 9570464 missense probably damaging 0.99
R9779:Grm3 UTSW 5 9511656 missense possibly damaging 0.74
X0020:Grm3 UTSW 5 9512195 missense probably damaging 1.00
X0025:Grm3 UTSW 5 9485790 missense probably damaging 1.00
X0026:Grm3 UTSW 5 9512238 nonsense probably null
Z1088:Grm3 UTSW 5 9570183 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCCCCATAGTCACCTTCAGAG -3'
(R):5'- AAACACTACCTGCTTTGGACCTG -3'

Sequencing Primer
(F):5'- CCTTCAGAGGCAACAGTGGAC -3'
(R):5'- GCTTGCTCCCTATATCTAAACATGG -3'
Posted On 2015-02-05