Mutagenetix > Incidental Mutations

Incidental Mutation 'R3116:Tln2'

264032

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

040589-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R3116 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67355139 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 610 (D610V)

Ref Sequence

ENSEMBL: ENSMUSP00000039633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784]

Predicted Effect

probably benign
Transcript: ENSMUST00000039662
AA Change: D610V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: D610V

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000040025
AA Change: D610V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: D610V

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215784
AA Change: D612V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	T	5: 8,896,610	I37F	possibly damaging	Het
Ccdc146	T	C	5: 21,316,955	N357S	probably benign	Het
Csmd3	A	G	15: 47,657,599	F2783S	probably damaging	Het
Desi2	T	A	1: 178,244,442	M104K	probably damaging	Het
Disp1	C	T	1: 183,088,922	V645I	probably benign	Het
Dock8	A	T	19: 25,188,494	H1914L	probably benign	Het
Fdft1	T	C	14: 63,177,698	I28M	probably benign	Het
Ffar3	T	C	7: 30,855,806	M30V	probably benign	Het
Grm3	A	T	5: 9,570,752	F164Y	probably damaging	Het
Ints5	T	C	19: 8,894,772	S32P	possibly damaging	Het
Itgam	T	A	7: 128,116,029	S908R	probably damaging	Het
Kif20b	C	T	19: 34,970,080	P1565L	probably benign	Het
Kntc1	A	G	5: 123,802,058	E1610G	probably damaging	Het
Krt24	T	A	11: 99,282,436	T298S	possibly damaging	Het
Magoh	T	C	4: 107,887,212	V126A	possibly damaging	Het
March6	G	A	15: 31,486,119	S362F	probably benign	Het
Mier3	T	A	13: 111,706,648	I178N	probably damaging	Het
Moxd1	G	T	10: 24,301,531	E582*	probably null	Het
Ncor2	A	T	5: 125,024,166	L2195Q	probably damaging	Het
Neil1	A	T	9: 57,146,663	D124E	probably benign	Het
Nhsl1	A	T	10: 18,525,168	Q714L	probably damaging	Het
Nipbl	T	A	15: 8,343,592	M1057L	probably benign	Het
Npas3	G	A	12: 54,067,725		probably null	Het
Oas1h	C	T	5: 120,861,616	Q55*	probably null	Het
Olfr39	A	T	9: 20,286,227	H176L	probably benign	Het
Olfr448	T	C	6: 42,896,850	V133A	probably benign	Het
Olfr485	T	C	7: 108,159,822	E17G	probably benign	Het
Olfr651	C	A	7: 104,553,088	H56Q	probably benign	Het
Olfr701	T	A	7: 106,818,364	F94I	probably damaging	Het
Phactr2	C	A	10: 13,261,901	E166*	probably null	Het
Prkdc	C	T	16: 15,664,358	L422F	probably benign	Het
Pum1	T	C	4: 130,772,660	V1051A	probably damaging	Het
Pxdn	T	C	12: 30,002,307	S828P	possibly damaging	Het
Rad21	T	A	15: 51,965,001	E557V	probably null	Het
Rtn3	T	G	19: 7,431,990	N888H	probably damaging	Het
Slc12a5	T	A	2: 164,996,181		probably null	Het
Slc7a11	T	A	3: 50,384,139	M274L	probably benign	Het
Svs1	A	G	6: 48,987,397	Y113C	probably damaging	Het
Tacc2	A	G	7: 130,759,249	N825S	probably damaging	Het
Tldc1	G	A	8: 119,768,317	A234V	probably benign	Het
Tmed11	C	T	5: 108,779,839	V110M	probably damaging	Het
Tmem92	T	C	11: 94,782,428	D3G	possibly damaging	Het
Trp53rkb	C	T	2: 166,794,089		probably benign	Het
Wdr91	A	G	6: 34,905,587	L209P	probably damaging	Het
Zfp511	T	A	7: 140,036,591	D46E	probably benign	Het
Zfp804a	C	A	2: 82,259,417	Q1197K	probably damaging	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0107:Tln2	UTSW	9	67370706	missense	probably damaging	1.00
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1527:Tln2	UTSW	9	67272668	missense	possibly damaging	0.95
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2152:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2153:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4697:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R7931:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
R8495:Tln2	UTSW	9	67354467	missense	probably benign	0.01
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TGGTAGAAACCTTTCAGGAAGC -3'
(R):5'- TCCTGCCAATGGGAGTTTTGAG -3'

Sequencing Primer
(F):5'- TTTCAGGAAGCCAGAGCCC -3'
(R):5'- GAGAAAGTCTCATCAGGCCTGC -3'

Posted On

2015-02-05