Incidental Mutation 'R3083:Tomm40l'
ID264055
Institutional Source Beutler Lab
Gene Symbol Tomm40l
Ensembl Gene ENSMUSG00000005674
Gene Nametranslocase of outer mitochondrial membrane 40-like
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171216011-171222514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171221211 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 78 (L78H)
Ref Sequence ENSEMBL: ENSMUSP00000119006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005820] [ENSMUST00000005824] [ENSMUST00000075469] [ENSMUST00000111319] [ENSMUST00000111320] [ENSMUST00000111321] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000111328] [ENSMUST00000133075] [ENSMUST00000147246] [ENSMUST00000138184] [ENSMUST00000143405] [ENSMUST00000155126]
Predicted Effect probably damaging
Transcript: ENSMUST00000005817
AA Change: L78H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674
AA Change: L78H

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000005820
SMART Domains Protein: ENSMUSP00000005820
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 333 5.55e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000005824
SMART Domains Protein: ENSMUSP00000005824
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075469
SMART Domains Protein: ENSMUSP00000074915
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 285 8.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111319
SMART Domains Protein: ENSMUSP00000106951
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 98 2.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111320
SMART Domains Protein: ENSMUSP00000106952
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111321
SMART Domains Protein: ENSMUSP00000106953
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111326
AA Change: L78H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674
AA Change: L78H

DomainStartEndE-ValueType
Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111327
AA Change: L78H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674
AA Change: L78H

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111328
SMART Domains Protein: ENSMUSP00000106960
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 332 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect probably benign
Transcript: ENSMUST00000133075
SMART Domains Protein: ENSMUSP00000137852
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
ZnF_C4 18 58 1.68e-3 SMART
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137298
Predicted Effect probably damaging
Transcript: ENSMUST00000147246
AA Change: L78H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674
AA Change: L78H

DomainStartEndE-ValueType
Pfam:Porin_3 26 91 5e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138184
AA Change: L78H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674
AA Change: L78H

DomainStartEndE-ValueType
Pfam:Porin_3 26 119 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149404
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Predicted Effect probably benign
Transcript: ENSMUST00000155126
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
HOLI 36 196 5.55e-29 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Tomm40l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Tomm40l APN 1 171220309 splice site probably null
IGL01996:Tomm40l APN 1 171219655 missense possibly damaging 0.95
IGL02237:Tomm40l APN 1 171220894 missense possibly damaging 0.88
IGL02548:Tomm40l APN 1 171221647 unclassified probably benign
R1612:Tomm40l UTSW 1 171221902 critical splice donor site probably null
R2164:Tomm40l UTSW 1 171220134 missense probably damaging 1.00
R2219:Tomm40l UTSW 1 171221981 nonsense probably null
R2220:Tomm40l UTSW 1 171221981 nonsense probably null
R4748:Tomm40l UTSW 1 171219562 nonsense probably null
R4749:Tomm40l UTSW 1 171219562 nonsense probably null
R6358:Tomm40l UTSW 1 171219637 missense possibly damaging 0.77
R6457:Tomm40l UTSW 1 171220592 missense probably damaging 1.00
R8394:Tomm40l UTSW 1 171221207 missense probably damaging 0.97
X0026:Tomm40l UTSW 1 171221575 missense probably damaging 1.00
Z1176:Tomm40l UTSW 1 171220648 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTTTGCACAGGACTAGCTCG -3'
(R):5'- TGCCTTTAAGCAACAAGATGTGG -3'

Sequencing Primer
(F):5'- ACTAGCTCGCGTTCAGAAG -3'
(R):5'- TGCTTAAAGTCCAGTGGCC -3'
Posted On2015-02-05