Incidental Mutation 'R3083:Slitrk3'
ID264061
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73048595 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 948 (D948G)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably benign
Transcript: ENSMUST00000059407
AA Change: D948G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: D948G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192141
Predicted Effect probably benign
Transcript: ENSMUST00000192477
AA Change: D948G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: D948G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
R7577:Slitrk3 UTSW 3 73051115 missense probably damaging 0.99
R7757:Slitrk3 UTSW 3 73050839 missense probably damaging 1.00
R8251:Slitrk3 UTSW 3 73049396 missense possibly damaging 0.67
R8354:Slitrk3 UTSW 3 73049180 missense probably benign 0.08
R8454:Slitrk3 UTSW 3 73049180 missense probably benign 0.08
R8488:Slitrk3 UTSW 3 73051187 missense probably benign 0.02
R8491:Slitrk3 UTSW 3 73051259 missense possibly damaging 0.89
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Z1176:Slitrk3 UTSW 3 73048770 missense probably benign 0.09
Z1177:Slitrk3 UTSW 3 73049142 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCTGTCCTAGGCAGG -3'
(R):5'- TCTGCTACTAGACCGTGAGAGG -3'

Sequencing Primer
(F):5'- TTCTGTCCTAGGCAGGGGAAAC -3'
(R):5'- CTAGACCGTGAGAGGCCACAG -3'
Posted On2015-02-05