Incidental Mutation 'R3083:Rtca'
ID264062
Institutional Source Beutler Lab
Gene Symbol Rtca
Ensembl Gene ENSMUSG00000000339
Gene NameRNA 3'-terminal phosphate cyclase
Synonyms2310009A18Rik, Rtcd1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R3083 (G1)
Quality Score106
Status Not validated
Chromosome3
Chromosomal Location116488963-116508208 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 116508025 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000348] [ENSMUST00000140677] [ENSMUST00000143425] [ENSMUST00000153005]
Predicted Effect probably benign
Transcript: ENSMUST00000000348
SMART Domains Protein: ENSMUSP00000000348
Gene: ENSMUSG00000000339

DomainStartEndE-ValueType
Pfam:RTC 12 338 4.3e-89 PFAM
Pfam:RTC_insert 185 287 4.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140677
SMART Domains Protein: ENSMUSP00000117610
Gene: ENSMUSG00000000339

DomainStartEndE-ValueType
Pfam:RTC 8 51 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143425
SMART Domains Protein: ENSMUSP00000121357
Gene: ENSMUSG00000000339

DomainStartEndE-ValueType
Pfam:RTC 8 102 9.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153005
SMART Domains Protein: ENSMUSP00000119463
Gene: ENSMUSG00000000339

DomainStartEndE-ValueType
Pfam:RTC 1 133 1.1e-27 PFAM
Pfam:RTC_insert 78 142 2e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA 3'-phosphate cyclase family. The encoded protein plays a role in RNA metabolism by catalyzing the ATP-dependent conversion of the 3'-phosphate of RNA substrates to a 2',3'-cyclic phosphodiester. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit incomplete prenatal lethality and enhanced retinal ganglion cell axon regeneration after optic nerve crush injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Rtca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Rtca APN 3 116504461 missense probably damaging 0.96
IGL02793:Rtca APN 3 116493077 missense probably damaging 1.00
IGL03028:Rtca APN 3 116493092 unclassified probably benign
R1749:Rtca UTSW 3 116497644 missense possibly damaging 0.83
R1858:Rtca UTSW 3 116494115 missense probably benign 0.30
R2127:Rtca UTSW 3 116497674 missense possibly damaging 0.85
R3750:Rtca UTSW 3 116493001 missense probably benign 0.02
R5493:Rtca UTSW 3 116499631 missense probably benign
R5502:Rtca UTSW 3 116489282 nonsense probably null
R5889:Rtca UTSW 3 116499583 missense possibly damaging 0.87
R6151:Rtca UTSW 3 116507827 missense probably benign 0.04
R6763:Rtca UTSW 3 116507749 critical splice donor site probably null
R8184:Rtca UTSW 3 116507824 missense probably benign 0.01
Z1176:Rtca UTSW 3 116489303 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCGCACTCTTAATTGCC -3'
(R):5'- TTTGGGTACACAGTCGCACAAC -3'

Sequencing Primer
(F):5'- TGGAGACCCTGAGGATCTG -3'
(R):5'- CTCTCTGAGCGCTGGGTG -3'
Posted On2015-02-05