Incidental Mutation 'R3083:Smu1'
ID264063
Institutional Source Beutler Lab
Gene Symbol Smu1
Ensembl Gene ENSMUSG00000028409
Gene Namesmu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms2610203K23Rik, 2600001O03Rik, SMU-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location40736542-40757923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40745567 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 251 (D251G)
Ref Sequence ENSEMBL: ENSMUSP00000030117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030117]
Predicted Effect probably damaging
Transcript: ENSMUST00000030117
AA Change: D251G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030117
Gene: ENSMUSG00000028409
AA Change: D251G

DomainStartEndE-ValueType
LisH 6 38 9.95e-7 SMART
CTLH 40 92 2.32e-7 SMART
WD40 202 242 9.02e-7 SMART
WD40 253 292 3.81e-5 SMART
WD40 295 335 5.26e-8 SMART
WD40 338 377 4.4e-10 SMART
WD40 380 426 1.03e1 SMART
WD40 428 470 2.97e0 SMART
WD40 473 512 9.52e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130503
Meta Mutation Damage Score 0.4850 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Smu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Smu1 APN 4 40739550 missense probably damaging 0.97
IGL03271:Smu1 APN 4 40738408 missense probably benign 0.11
IGL03329:Smu1 APN 4 40739568 missense possibly damaging 0.81
PIT4585001:Smu1 UTSW 4 40739623 missense probably benign
R0172:Smu1 UTSW 4 40738439 missense probably benign 0.00
R1109:Smu1 UTSW 4 40755722 missense probably benign 0.12
R1552:Smu1 UTSW 4 40748570 missense probably damaging 1.00
R1799:Smu1 UTSW 4 40745537 missense probably damaging 1.00
R2093:Smu1 UTSW 4 40738438 missense probably benign 0.12
R2143:Smu1 UTSW 4 40744073 missense probably damaging 0.99
R3082:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3113:Smu1 UTSW 4 40748658 missense probably benign 0.03
R3157:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3158:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3159:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3409:Smu1 UTSW 4 40752008 missense probably benign
R3411:Smu1 UTSW 4 40752008 missense probably benign
R4581:Smu1 UTSW 4 40737401 splice site probably null
R5106:Smu1 UTSW 4 40743104 missense possibly damaging 0.82
R7747:Smu1 UTSW 4 40748600 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGATAATGAATGTCATGTGTACCAC -3'
(R):5'- TTCTATCAGGTGTTCATAAGGAAGC -3'

Sequencing Primer
(F):5'- GCCATCAAGTTCTACAGAGTCAGTTC -3'
(R):5'- CTGTACGGGACACAGCTCTTTG -3'
Posted On2015-02-05