Incidental Mutation 'R3083:Gm15446'
ID264065
Institutional Source Beutler Lab
Gene Symbol Gm15446
Ensembl Gene ENSMUSG00000090015
Gene Namepredicted gene 15446
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3083 (G1)
Quality Score202
Status Not validated
Chromosome5
Chromosomal Location109923400-109943936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109943292 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 470 (N470S)
Ref Sequence ENSEMBL: ENSMUSP00000108163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112544] [ENSMUST00000170826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112544
AA Change: N470S

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108163
Gene: ENSMUSG00000090015
AA Change: N470S

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 4.87e-4 SMART
ZnF_C2H2 187 209 3.39e-3 SMART
ZnF_C2H2 215 237 1.76e-1 SMART
ZnF_C2H2 243 265 1.3e-4 SMART
ZnF_C2H2 271 293 1.1e-2 SMART
ZnF_C2H2 299 321 2.27e-4 SMART
ZnF_C2H2 327 349 6.99e-5 SMART
ZnF_C2H2 355 377 5.21e-4 SMART
ZnF_C2H2 383 405 9.73e-4 SMART
ZnF_C2H2 411 433 3.39e-3 SMART
ZnF_C2H2 439 461 1.58e-3 SMART
ZnF_C2H2 467 489 5.14e-3 SMART
ZnF_C2H2 495 517 2.61e-4 SMART
ZnF_C2H2 523 545 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146564
Predicted Effect probably benign
Transcript: ENSMUST00000170826
SMART Domains Protein: ENSMUSP00000127438
Gene: ENSMUSG00000090015

DomainStartEndE-ValueType
KRAB 3 59 1.74e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Gm15446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Gm15446 APN 5 109940802 makesense probably null
R0278:Gm15446 UTSW 5 109943415 missense probably benign 0.14
R0606:Gm15446 UTSW 5 109943481 missense probably benign
R1608:Gm15446 UTSW 5 109942457 missense probably damaging 1.00
R1874:Gm15446 UTSW 5 109942553 missense probably damaging 0.99
R1892:Gm15446 UTSW 5 109943387 missense probably damaging 1.00
R2000:Gm15446 UTSW 5 109942811 missense possibly damaging 0.67
R2059:Gm15446 UTSW 5 109942496 missense probably damaging 1.00
R3883:Gm15446 UTSW 5 109940447 missense probably damaging 0.98
R4086:Gm15446 UTSW 5 109943255 missense probably benign 0.02
R4095:Gm15446 UTSW 5 109940724 splice site probably null
R4459:Gm15446 UTSW 5 109943241 missense probably benign 0.03
R4721:Gm15446 UTSW 5 109943000 missense probably damaging 1.00
R4735:Gm15446 UTSW 5 109942952 missense probably damaging 1.00
R5229:Gm15446 UTSW 5 109943170 missense probably damaging 1.00
R5502:Gm15446 UTSW 5 109940498 nonsense probably null
R6116:Gm15446 UTSW 5 109943036 missense probably damaging 1.00
R6166:Gm15446 UTSW 5 109942780 nonsense probably null
R6322:Gm15446 UTSW 5 109943517 missense probably damaging 1.00
R7871:Gm15446 UTSW 5 109943299 nonsense probably null
R7939:Gm15446 UTSW 5 109942494 missense probably benign 0.22
R8045:Gm15446 UTSW 5 109940528 missense probably damaging 1.00
R8069:Gm15446 UTSW 5 109940440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGTAAAGCCTTTGCCTCT -3'
(R):5'- AGGCTTTACCACATTGATCACAT -3'

Sequencing Primer
(F):5'- TTCATACTGGCGAGAAACCTTAC -3'
(R):5'- CCACATTGATCACATTTGTAGGG -3'
Posted On2015-02-05