Incidental Mutation 'R3083:Olfr917'
ID264069
Institutional Source Beutler Lab
Gene Symbol Olfr917
Ensembl Gene ENSMUSG00000063225
Gene Nameolfactory receptor 917
SynonymsGA_x6K02T2PVTD-32368166-32367237, MOR168-2P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38664913-38665842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38665616 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000075857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076542] [ENSMUST00000215461]
Predicted Effect probably damaging
Transcript: ENSMUST00000076542
AA Change: V76A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075857
Gene: ENSMUSG00000063225
AA Change: V76A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.2e-42 PFAM
Pfam:7tm_1 41 289 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213750
Predicted Effect probably benign
Transcript: ENSMUST00000215461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217596
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Olfr917
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Olfr917 APN 9 38664993 missense probably benign
IGL02704:Olfr917 APN 9 38665767 missense possibly damaging 0.84
R0529:Olfr917 UTSW 9 38665512 missense probably benign 0.11
R1575:Olfr917 UTSW 9 38665277 missense probably damaging 1.00
R1681:Olfr917 UTSW 9 38665320 missense probably benign
R2941:Olfr917 UTSW 9 38665026 missense probably damaging 0.98
R4450:Olfr917 UTSW 9 38665754 missense probably benign 0.17
R4755:Olfr917 UTSW 9 38665832 missense probably benign
R4774:Olfr917 UTSW 9 38665223 missense probably benign 0.21
R5322:Olfr917 UTSW 9 38665206 missense probably benign 0.24
R5577:Olfr917 UTSW 9 38665001 missense possibly damaging 0.49
R6101:Olfr917 UTSW 9 38665620 missense probably damaging 0.99
R6105:Olfr917 UTSW 9 38665620 missense probably damaging 0.99
R7084:Olfr917 UTSW 9 38665269 missense probably benign 0.04
R8048:Olfr917 UTSW 9 38665812 missense probably benign 0.03
R8280:Olfr917 UTSW 9 38665487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAAACAAGCATTAGGTTCAAGC -3'
(R):5'- GGTGGGATTAACTGACAAGCC -3'

Sequencing Primer
(F):5'- GGTTCAAGCATAATTTAGAGGACATG -3'
(R):5'- GGTGGGATTAACTGACAAGCCTTATC -3'
Posted On2015-02-05