Incidental Mutation 'R0344:Or5m8'
ID 26407
Institutional Source Beutler Lab
Gene Symbol Or5m8
Ensembl Gene ENSMUSG00000043267
Gene Name olfactory receptor family 5 subfamily M member 8
Synonyms GA_x6K02T2Q125-47470765-47471775, Olfr1031, MOR200-1
MMRRC Submission 038551-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R0344 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85822163-85823173 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 85822726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 188 (C188*)
Ref Sequence ENSEMBL: ENSMUSP00000149225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050942] [ENSMUST00000056849] [ENSMUST00000216807]
AlphaFold Q7TR87
Predicted Effect probably null
Transcript: ENSMUST00000050942
AA Change: C188*
SMART Domains Protein: ENSMUSP00000059256
Gene: ENSMUSG00000043267
AA Change: C188*

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-55 PFAM
Pfam:7tm_1 40 289 6.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216807
AA Change: C188*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,617,189 (GRCm39) C29* probably null Het
Abca4 G A 3: 121,877,613 (GRCm39) C324Y probably damaging Het
Ablim2 T G 5: 35,994,277 (GRCm39) probably benign Het
Abr A T 11: 76,369,870 (GRCm39) V115E probably damaging Het
Adgrl2 C T 3: 148,571,231 (GRCm39) probably null Het
Aff3 A T 1: 38,243,013 (GRCm39) S936T probably benign Het
Agap3 T C 5: 24,656,200 (GRCm39) probably benign Het
Ahrr T A 13: 74,362,705 (GRCm39) S393C probably damaging Het
Amfr T C 8: 94,713,998 (GRCm39) probably null Het
Ankrd26 C A 6: 118,484,598 (GRCm39) probably null Het
Asxl3 G A 18: 22,650,668 (GRCm39) V886I probably benign Het
Atp5f1a C A 18: 77,867,895 (GRCm39) N356K probably damaging Het
AU021092 A T 16: 5,040,031 (GRCm39) M31K possibly damaging Het
Bicral A G 17: 47,124,978 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C3ar1 T C 6: 122,827,731 (GRCm39) D162G probably benign Het
Camkk2 C T 5: 122,901,940 (GRCm39) C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 (GRCm39) I1051F probably damaging Het
Catsperg1 A T 7: 28,894,965 (GRCm39) V544E probably damaging Het
Cdc27 G A 11: 104,417,817 (GRCm39) probably benign Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Dennd6b T C 15: 89,080,432 (GRCm39) Q56R probably benign Het
Dmac2l T C 12: 69,787,663 (GRCm39) probably benign Het
Fbxl17 G A 17: 63,692,062 (GRCm39) probably benign Het
Fubp1 T C 3: 151,925,350 (GRCm39) V164A probably damaging Het
Gdap2 G A 3: 100,085,572 (GRCm39) G165S probably damaging Het
Gns A G 10: 121,219,328 (GRCm39) K352E probably benign Het
Gtf2ird2 C T 5: 134,220,088 (GRCm39) T22M probably damaging Het
Herc3 A G 6: 58,845,613 (GRCm39) probably benign Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Inpp1 A T 1: 52,838,513 (GRCm39) F45L probably damaging Het
Ipo4 T C 14: 55,863,399 (GRCm39) Q1073R possibly damaging Het
Itgae A G 11: 73,008,973 (GRCm39) K485E probably benign Het
Jak2 G A 19: 29,261,029 (GRCm39) V342I probably damaging Het
Kptn C A 7: 15,859,666 (GRCm39) Q297K probably damaging Het
Lims2 A G 18: 32,077,573 (GRCm39) E103G probably benign Het
Mthfr C G 4: 148,139,885 (GRCm39) S618W probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nup133 A G 8: 124,644,185 (GRCm39) V727A possibly damaging Het
Oas2 T G 5: 120,881,152 (GRCm39) E313A probably damaging Het
Or10d4c G A 9: 39,558,646 (GRCm39) C208Y probably damaging Het
Or52b2 C A 7: 104,986,814 (GRCm39) M36I probably benign Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Or5p63 A T 7: 107,810,949 (GRCm39) Y262* probably null Het
Park7 A G 4: 150,992,806 (GRCm39) V20A possibly damaging Het
Pgap4 T C 4: 49,586,566 (GRCm39) T201A probably benign Het
Phldb1 C A 9: 44,612,964 (GRCm39) V919L probably benign Het
Pkhd1l1 C A 15: 44,460,407 (GRCm39) H4205Q probably benign Het
Plekhg3 G T 12: 76,613,040 (GRCm39) E449* probably null Het
Pramel26 A T 4: 143,537,338 (GRCm39) I331N probably damaging Het
Pstpip1 T C 9: 56,033,929 (GRCm39) V301A probably benign Het
Ptdss1 G A 13: 67,081,636 (GRCm39) R22H probably damaging Het
Ptprq A G 10: 107,541,443 (GRCm39) V361A probably benign Het
Ralgapa2 A T 2: 146,188,714 (GRCm39) V1309E possibly damaging Het
Rere T C 4: 150,695,438 (GRCm39) probably benign Het
Sbk3 T A 7: 4,970,404 (GRCm39) T322S possibly damaging Het
Scn9a T A 2: 66,335,354 (GRCm39) I1203L probably damaging Het
Setdb1 A T 3: 95,233,442 (GRCm39) probably benign Het
Sik3 C A 9: 46,120,109 (GRCm39) Q683K probably damaging Het
Slc24a5 A G 2: 124,927,621 (GRCm39) I307V probably benign Het
Smg6 A G 11: 74,820,647 (GRCm39) D306G probably damaging Het
Snx13 G A 12: 35,136,899 (GRCm39) W120* probably null Het
Snx5 A G 2: 144,099,128 (GRCm39) probably benign Het
Srsf5 T C 12: 80,994,298 (GRCm39) S76P probably benign Het
Stard6 A G 18: 70,629,186 (GRCm39) D31G probably damaging Het
Taf3 A G 2: 9,956,709 (GRCm39) M333T probably benign Het
Taf6 T G 5: 138,179,409 (GRCm39) I377L probably benign Het
Taf8 G T 17: 47,804,505 (GRCm39) N252K probably benign Het
Tfap2c A G 2: 172,393,423 (GRCm39) T113A probably benign Het
Tmtc4 C T 14: 123,215,572 (GRCm39) V25M probably damaging Het
Topbp1 T A 9: 103,205,886 (GRCm39) D841E probably damaging Het
Topbp1 T A 9: 103,185,932 (GRCm39) probably benign Het
Ttn A T 2: 76,542,833 (GRCm39) D33384E probably damaging Het
Unc13c T C 9: 73,838,067 (GRCm39) E928G probably benign Het
Vav1 T C 17: 57,603,090 (GRCm39) F81L probably damaging Het
Vmn2r63 A G 7: 42,553,042 (GRCm39) I738T probably damaging Het
Vmn2r87 C T 10: 130,315,806 (GRCm39) E87K probably damaging Het
Zfp229 A T 17: 21,964,822 (GRCm39) M351L probably benign Het
Other mutations in Or5m8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Or5m8 APN 2 85,822,730 (GRCm39) missense probably damaging 1.00
IGL02475:Or5m8 APN 2 85,822,376 (GRCm39) missense probably benign 0.19
IGL03230:Or5m8 APN 2 85,822,583 (GRCm39) missense probably benign 0.00
IGL03405:Or5m8 APN 2 85,822,230 (GRCm39) missense possibly damaging 0.84
PIT4151001:Or5m8 UTSW 2 85,822,538 (GRCm39) missense probably damaging 0.96
PIT4366001:Or5m8 UTSW 2 85,822,385 (GRCm39) missense probably damaging 1.00
R1168:Or5m8 UTSW 2 85,823,028 (GRCm39) missense probably damaging 1.00
R1170:Or5m8 UTSW 2 85,823,040 (GRCm39) missense probably damaging 1.00
R2345:Or5m8 UTSW 2 85,822,166 (GRCm39) missense probably benign 0.01
R2915:Or5m8 UTSW 2 85,822,389 (GRCm39) missense probably damaging 1.00
R3498:Or5m8 UTSW 2 85,822,774 (GRCm39) missense probably benign 0.43
R4058:Or5m8 UTSW 2 85,822,576 (GRCm39) missense possibly damaging 0.87
R4747:Or5m8 UTSW 2 85,822,271 (GRCm39) missense probably damaging 1.00
R4859:Or5m8 UTSW 2 85,823,075 (GRCm39) missense probably damaging 0.96
R4991:Or5m8 UTSW 2 85,822,631 (GRCm39) missense probably damaging 0.99
R5438:Or5m8 UTSW 2 85,822,925 (GRCm39) missense probably damaging 1.00
R6362:Or5m8 UTSW 2 85,822,285 (GRCm39) missense probably damaging 1.00
R7458:Or5m8 UTSW 2 85,822,994 (GRCm39) missense probably damaging 1.00
R7535:Or5m8 UTSW 2 85,822,245 (GRCm39) missense probably benign 0.37
R8807:Or5m8 UTSW 2 85,823,172 (GRCm39) makesense probably null
R9130:Or5m8 UTSW 2 85,822,819 (GRCm39) nonsense probably null
R9366:Or5m8 UTSW 2 85,822,731 (GRCm39) missense possibly damaging 0.88
R9687:Or5m8 UTSW 2 85,822,220 (GRCm39) missense probably benign
R9746:Or5m8 UTSW 2 85,823,091 (GRCm39) missense probably benign 0.18
R9794:Or5m8 UTSW 2 85,822,464 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCTCATCAAGGCCAATGCCAG -3'
(R):5'- TCATGGGGTTCAACATGGGAATGAC -3'

Sequencing Primer
(F):5'- AACCCTCTGCTTTATGGTAGCAAG -3'
(R):5'- CCACAGACTCTCTAGATGTTGG -3'
Posted On 2013-04-16