Incidental Mutation 'R3083:Armc2'
ID264071
Institutional Source Beutler Lab
Gene Symbol Armc2
Ensembl Gene ENSMUSG00000071324
Gene Namearmadillo repeat containing 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location41914990-42018442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41966730 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 359 (D359G)
Ref Sequence ENSEMBL: ENSMUSP00000125412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095729] [ENSMUST00000160262] [ENSMUST00000161927]
Predicted Effect probably damaging
Transcript: ENSMUST00000095729
AA Change: D359G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093397
Gene: ENSMUSG00000071324
AA Change: D359G

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105503
Predicted Effect probably damaging
Transcript: ENSMUST00000160262
AA Change: D359G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125412
Gene: ENSMUSG00000071324
AA Change: D359G

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160367
Predicted Effect probably benign
Transcript: ENSMUST00000161927
SMART Domains Protein: ENSMUSP00000124049
Gene: ENSMUSG00000071324

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Armc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Armc2 UTSW 10 41947887 splice site probably benign
R0144:Armc2 UTSW 10 41947887 splice site probably benign
R0427:Armc2 UTSW 10 42000410 missense possibly damaging 0.87
R0540:Armc2 UTSW 10 41922695 missense probably benign 0.11
R0561:Armc2 UTSW 10 41993192 missense probably benign 0.02
R0607:Armc2 UTSW 10 41922695 missense probably benign 0.11
R1099:Armc2 UTSW 10 41917187 missense probably benign 0.39
R1130:Armc2 UTSW 10 42011834 missense possibly damaging 0.85
R2116:Armc2 UTSW 10 41963667 missense probably damaging 0.98
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2873:Armc2 UTSW 10 41966700 critical splice donor site probably null
R3771:Armc2 UTSW 10 41922227 missense probably damaging 1.00
R3784:Armc2 UTSW 10 41922194 missense probably benign 0.08
R3880:Armc2 UTSW 10 41963725 missense possibly damaging 0.71
R4024:Armc2 UTSW 10 41993058 missense probably benign
R4155:Armc2 UTSW 10 42011867 missense probably damaging 0.96
R4370:Armc2 UTSW 10 41917200 missense probably benign 0.13
R4378:Armc2 UTSW 10 41993082 missense possibly damaging 0.66
R4896:Armc2 UTSW 10 41923794 missense probably damaging 1.00
R5119:Armc2 UTSW 10 41922148 missense probably damaging 1.00
R5159:Armc2 UTSW 10 42008715 missense probably damaging 0.96
R5517:Armc2 UTSW 10 41963850 missense probably benign 0.29
R5640:Armc2 UTSW 10 42011898 missense possibly damaging 0.87
R5767:Armc2 UTSW 10 42011927 missense probably benign 0.02
R5965:Armc2 UTSW 10 41922572 missense possibly damaging 0.94
R6897:Armc2 UTSW 10 41993229 critical splice acceptor site probably null
R7233:Armc2 UTSW 10 41923804 missense probably damaging 1.00
R7829:Armc2 UTSW 10 41926860 missense probably benign
R7832:Armc2 UTSW 10 41966796 missense probably damaging 1.00
R7999:Armc2 UTSW 10 42011958 missense possibly damaging 0.62
R8029:Armc2 UTSW 10 41927000 missense probably damaging 1.00
R8030:Armc2 UTSW 10 41966742 missense possibly damaging 0.73
R8033:Armc2 UTSW 10 42008684 missense possibly damaging 0.87
R8191:Armc2 UTSW 10 41963751 missense probably benign 0.29
R8304:Armc2 UTSW 10 41947939 missense probably damaging 1.00
R8334:Armc2 UTSW 10 41923765 missense probably damaging 1.00
R8370:Armc2 UTSW 10 41923837 missense possibly damaging 0.96
Z1176:Armc2 UTSW 10 41927044 missense probably damaging 1.00
Z1176:Armc2 UTSW 10 41963656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCTGGTCACAGTAGACTC -3'
(R):5'- AGGTGGCCTAAACCTTCCTAGG -3'

Sequencing Primer
(F):5'- TGAGCTGGTCACAGTAGACTCTAAAC -3'
(R):5'- GAACGTTTCTCATGTTTTAAACCC -3'
Posted On2015-02-05