Incidental Mutation 'R3083:Hist3h2ba'
ID264074
Institutional Source Beutler Lab
Gene Symbol Hist3h2ba
Ensembl Gene ENSMUSG00000056895
Gene Namehistone cluster 3, H2ba
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58948920-58949533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58948976 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 13 (K13E)
Ref Sequence ENSEMBL: ENSMUSP00000076397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078267]
PDB Structure
Crystal structure of the nucleosome core particle containing the histone domain of macroH2A [X-RAY DIFFRACTION]
2.9 Angstrom X-ray structure of hybrid macroH2A nucleosomes [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000078267
AA Change: K13E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000076397
Gene: ENSMUSG00000056895
AA Change: K13E

DomainStartEndE-ValueType
H2B 28 124 4.33e-72 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Hist3h2ba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02832:Hist3h2ba APN 11 58949043 missense probably benign 0.06
R1848:Hist3h2ba UTSW 11 58949102 missense possibly damaging 0.94
R4193:Hist3h2ba UTSW 11 58949241 missense probably damaging 1.00
R4657:Hist3h2ba UTSW 11 58948971 missense probably benign 0.09
R5550:Hist3h2ba UTSW 11 58949320 makesense probably null
R5777:Hist3h2ba UTSW 11 58949009 missense probably benign 0.00
R7671:Hist3h2ba UTSW 11 58949276 missense possibly damaging 0.70
X0019:Hist3h2ba UTSW 11 58949055 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTGCCAATACACTTTCGGATTG -3'
(R):5'- GCGCTCGAAGATGTCATTGAC -3'

Sequencing Primer
(F):5'- CCAATACACTTTCGGATTGGTTGG -3'
(R):5'- CATTGACGAACGAGTTCATGATGCC -3'
Posted On2015-02-05