Incidental Mutation 'R3083:Fbln1'
ID264078
Institutional Source Beutler Lab
Gene Symbol Fbln1
Ensembl Gene ENSMUSG00000006369
Gene Namefibulin 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85205949-85286535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85265253 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 617 (I617S)
Ref Sequence ENSEMBL: ENSMUSP00000054583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057410]
Predicted Effect probably benign
Transcript: ENSMUST00000057410
AA Change: I617S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054583
Gene: ENSMUSG00000006369
AA Change: I617S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF 530 580 1.25e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160798
Meta Mutation Damage Score 0.6802 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibulin 1 is a secreted glycoprotein that becomes incorporated into a fibrillar extracellular matrix. Calcium-binding is apparently required to mediate its binding to laminin and nidogen. It mediates platelet adhesion via binding fibrinogen. Four splice variants which differ in the 3' end have been identified. Each variant encodes a different isoform, but no functional distinctions have been identified among the four variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene develop problems with spontaneous bleeding as embryos. Most die within the first two days of life. Those that survive this period develop normally and eventually recover from their early developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr1228 A C 2: 89,249,001 V231G probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Fbln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Fbln1 APN 15 85227037 missense probably benign 0.00
IGL01017:Fbln1 APN 15 85244189 missense possibly damaging 0.94
IGL02514:Fbln1 APN 15 85244262 nonsense probably null
IGL02693:Fbln1 APN 15 85229574 missense probably benign 0.00
IGL02734:Fbln1 APN 15 85226981 missense probably damaging 1.00
IGL02964:Fbln1 APN 15 85231462 missense probably damaging 1.00
IGL03176:Fbln1 APN 15 85244306 missense possibly damaging 0.69
IGL03274:Fbln1 APN 15 85232678 critical splice donor site probably null
R0090:Fbln1 UTSW 15 85224288 missense possibly damaging 0.94
R0148:Fbln1 UTSW 15 85230826 missense probably damaging 0.97
R0393:Fbln1 UTSW 15 85227076 missense probably damaging 0.99
R0564:Fbln1 UTSW 15 85227107 missense probably benign 0.07
R1276:Fbln1 UTSW 15 85229590 missense probably damaging 1.00
R1592:Fbln1 UTSW 15 85231464 missense probably benign 0.00
R1687:Fbln1 UTSW 15 85227106 missense probably benign 0.02
R2312:Fbln1 UTSW 15 85263348 missense probably benign 0.28
R2363:Fbln1 UTSW 15 85227140 critical splice donor site probably null
R3082:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3751:Fbln1 UTSW 15 85227078 nonsense probably null
R3752:Fbln1 UTSW 15 85227078 nonsense probably null
R3753:Fbln1 UTSW 15 85227078 nonsense probably null
R4028:Fbln1 UTSW 15 85227116 missense probably benign 0.05
R4406:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4407:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4408:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4612:Fbln1 UTSW 15 85238559 missense probably benign 0.00
R4811:Fbln1 UTSW 15 85226966 critical splice acceptor site probably null
R5022:Fbln1 UTSW 15 85237626 missense probably damaging 0.99
R5121:Fbln1 UTSW 15 85237671 missense probably damaging 1.00
R7231:Fbln1 UTSW 15 85206152 missense unknown
R7285:Fbln1 UTSW 15 85237628 missense probably benign 0.01
R7492:Fbln1 UTSW 15 85227061 missense probably damaging 1.00
R7742:Fbln1 UTSW 15 85240716 missense probably damaging 1.00
R8100:Fbln1 UTSW 15 85285156 missense probably damaging 1.00
R8379:Fbln1 UTSW 15 85232572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGTGAGGGCTAGGACTC -3'
(R):5'- TGCAGATGACCTTGGTCAATGC -3'

Sequencing Primer
(F):5'- TGAGGGCTAGGACTCTACCCTTC -3'
(R):5'- ATGACCTTGGTCAATGCCCTGG -3'
Posted On2015-02-05